Compounds and methods for modulating factor XII (2024)

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0369USEQ_ST25.txt, created on Dec. 8, 2021, which is 1 MB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

Provided herein are compounds, methods, and pharmaceutical compositions for reducing an amount of Factor XII (FXII) RNA in a cell or a subject, and in certain instances reducing the amount of FXII protein in a cell or a subject. Such compounds, methods, and pharmaceutical compositions are useful to treat or prevent a thromboembolic condition. Such thromboembolic conditions include myocardial infarction (MI), stroke, limb ischemia and necrosis, and venous thromboembolism (VTE), including deep vein thrombosis (DVT) and pulmonary embolism (PE).

The human F12 gene encodes FXII protein, a zymogen that circulates in the blood stream. The zymogen is converted to an active enzyme (FXIIa) by plasma kallikrein (PK) or by its unique ability to auto-activate following binding to artificial or biologic surfaces. In vivo, FXIIa triggers the kallikrein-kinin system leading to release of bradykinin (BK) which induces microvascular permeability, nitric oxide-mediated vasodilation, hypotension, and inflammatory reactions such as swelling, hyperperfusion, and pain. FXIIa also initiates coagulation via the intrinsic pathway and promotes inflammation via the kallikrein-kinin system comprising, high molecular weight kininogen (HK) and PK.

FXII may contribute to a variety of inflammatory, life-threatening disease conditions, including hereditary angioedema (HAE) and thrombosis. HAE is a rare life-threatening inherited disorder characterized by recurrent episodes of acute swelling in multiple organs because of increased vascular permeability. An excess of FXII activity may trigger excessive BK formation or signaling, thereby contributing to the vascular permeability of hereditary angioedema. Thrombosis is a maladaptive process of vascular occlusion and remains a primary cause of vascular morbidity and mortality associated with myocardial infarction (MI), stroke, limb ischemia and necrosis, and venous thromboembolism (VTE), including deep vein thrombosis (DVT) and pulmonary embolism (PE). VTE is the third leading cause of vascular-related death, after MI and stroke, and is one of the leading causes of death in patients with cancer. While many thromboembolic conditions are due to acquired extrinsic issues, (e.g. surgery, cancer, immobility), other thromboembolic conditions are due to a genetic mutation, (e.g., antiphospholipid syndrome, Factor V Leiden thrombophilia). The most commonly used treatments for thromboembolic conditions (e.g., warfarin, heparin) and newer direct oral anticoagulants all possess significant drawbacks, such as an increased risk of bleeding. It is therefore an object herein to provide compounds, methods, and pharmaceutical compositions for the treatment and prevention of such thromboembolic conditions.

Provided herein are compounds, methods and pharmaceutical compositions for reducing an amount of FXII RNA, and in certain embodiments reducing the amount or activity of FXII protein in a cell or a subject. In certain embodiments, compounds, methods and pharmaceutical compositions disclosed herein reduce FXII RNA, FXII protein, FXII activity, or a combination thereof, in the blood of a subject. In certain embodiments, the subject has or is at risk for a thromboembolic condition. In certain embodiments, the thromboembolic condition is deep vein thrombosis, venous thrombosis, arterial thrombosis, pulmonary embolism, myocardial infarction, or stroke. In certain embodiments, compounds useful for reducing the amount of FXII RNA, the amount of FXII protein, or FXII activity are oligomeric compounds. In certain embodiments, oligomeric compounds comprise modified oligonucleotides.

Also provided are herein are methods useful for preventing a thromboembolic condition and methods useful for ameliorating a symptom of a thromboembolic condition. Exemplary symptoms of a thromboembolic condition include, but are not limited to, pain, shortness of breath, heart burn, cold sweat, fatigue, lightheadedness, dizziness, swelling, cramping, and death.

Also provided are herein are methods useful for treating hereditary angioedema and methods useful for ameliorating a symptom of hereditary angioedema. Exemplary symptoms of hereditary angioedema include, but are not limited to, swelling, nausea, vomiting, itching, headache, fatigue, abdominal pain, shortness of breath, rhinitis, anaphylaxis, and bronchoconstriction.

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.

Unless otherwise indicated, the following terms have the following meanings:

As used herein, “2′-deoxynucleoside” means a nucleoside comprising a 2′-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2′-deoxynucleoside is a 2′-β-D-deoxynucleoside and comprises a 2′-β-D-deoxyribosyl sugar moiety, which has the β-D configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

As used herein, “2′-MOE” or “2′-MOE sugar moiety” means a 2′-OCH2CH2OCH3 group in place of the 2′-OH group of a ribosyl sugar moiety. “MOE” means methoxyethyl. Unless otherwise indicated, a 2′-MOE has the β-D stereochemical configuration.

As used herein, “2′-MOE nucleoside” means a nucleoside comprising a 2′-MOE sugar moiety.

As used herein, “2′-OMe” or “2′-O-methyl sugar moiety” means a 2′-OCH3 group in place of the 2′-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2′-OMe has the β-D stereochemical configuration.

As used herein, “2′-OMe nucleoside” means a nucleoside comprising a 2′-OMe sugar moiety.

As used herein, “2′-substituted nucleoside” means a nucleoside comprising a 2′-substituted sugar moiety. As used herein, “2′-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.

As used herein, “5-methyl cytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine is a modified nucleobase.

As used herein, “administering” means providing a pharmaceutical agent to a subject.

As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.

As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

As used herein, “antisense compound” means an oligomeric compound capable of achieving at least one antisense activity.

As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.

As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms of the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

As used herein, “cell-targeting moiety” means a conjugate moiety that interacts with a cell or a portion thereof. In certain embodiments, the cell-targeting moiety binds a receptor on a surface of a cell.

As used herein, “cEt nucleoside” means a nucleoside comprising a cEt modified sugar moiety.

As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, a subject, or a human.

As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of a target nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. As used herein, complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G). Complementary oligonucleotides and/or target nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to an oligonucleotide, or portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

As used herein, “conjugate group” means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide. In certain embodiments, the conjugate moiety comprises a cell-targeting moiety.

As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

As used herein, “conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

As used herein, “constrained ethyl” or “cEt” or “cEt modified sugar moiety” means a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4′-carbon and the 2′-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4′-CH(CH3)—O-2′, and wherein the methyl group of the bridge is in the S configuration.

As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

As used herein, “FXII RNA” is the RNA expression product of a human F12 gene.

As used herein, “FXII protein” is the protein expression product of a FXII RNA, including zymogen and activated forms FXII protein.

As used herein, “gapmer” means an oligonucleotide having a central region positioned between a 5′-region and a 3′-region. Each nucleoside of the 5′-region and the 3′-region comprises a modified sugar moiety. The 3′- and 5′-most nucleosides of the central region are 2′-deoxynucleosides. The “central region” may be referred to as a “gap”, and the “5′-region” and “3′-region” may also be referred to as a “wing.” The hybridization of a gapmer to a target nucleic acid results in RNase H mediated cleavage of the target nucleic acid.

As used herein, “hotspot region” is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.

As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

As used herein, “identifying a subject at risk for developing a thromboembolic condition” means identifying a subject having been diagnosed with a thromboembolic condition or identifying a subject that has a risk factor for developing a thromboembolic condition.

As used herein, “internucleoside linkage” means the covalent linkage between contiguous nucleosides in an oligonucleotide. As used herein, “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

As used herein, “mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.

As used herein, “motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methyl cytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.

As used herein, “nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).

As used herein, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound. The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”

As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, or sterile buffer solution. In certain embodiments, a pharmaceutically acceptable carrier or diluent is phosphate buffered saline.

As used herein, “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

As used herein, “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.

As used herein, “prevent” or “preventing” refers to delaying or forestalling the onset or development of a thromboembolic condition for a period of time or indefinitely.

As used herein, “prodrug” means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.

As used herein, “reducing the amount or activity,” or “inhibiting the amount or activity,” in connection with a gene transcript (RNA) refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.

As used herein, “reducing the amount or activity,” or “inhibiting the amount or activity,” in connection with a protein refers to a reduction or blockade of the protein's expression or activity relative to the protein expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of protein expression or activity.

As used herein, “RNA” means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.

As used herein, “RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.

As used herein, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

As used herein, “standard cell assay” means the assay described in Example 1 and reasonable variations thereof.

As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

As used herein, “subject” means a human or non-human subject.

As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2′-OH(H) β-D-ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) β-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.

As used herein, “sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.

As used herein, “symptom” means any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject.

As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.

As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves a symptom of a disease.

As used herein, “thromboembolic condition” means any disease or condition involving a thrombosis or an embolism. A thrombosis is a pathological development of a blood clot, and an embolism occurs when the blood clot migrates to another part of the body and interferes with organ function. Conditions in which a thrombosis and/or an embolism occur are collectively referred to as a thromboembolic condition. Depending on where the blood clot occurs or settles, it may result in a variety of thromboembolic conditions, e.g., deep vein thrombosis (DVT), myocardial infarction (MI), pulmonary embolism (PE), and stroke. In certain embodiments, the thromboembolic condition comprises deep vein thrombosis, venous thrombosis, arterial thrombosis, pulmonary embolism, myocardial infarction, or stroke. Thromboembolic conditions may also be referred to as thromboembolic events or thrombotic events.

The present disclosure provides the following non-limiting numbered embodiments:

Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a FXII RNA, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 20-5042.
Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, or 18 contiguous nucleobases of any of SEQ ID NOs: 3379 and 5006.
Embodiment 4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to: an equal length portion of nucleobases 1,899-1,979 of SEQ ID NO: 1; or an equal length portion of nucleobases 2,004-2,045 of SEQ ID NO: 1.
Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleobases of a sequence selected from: SEQ ID NOs: 92, 156, 270, 271, 345, 346, 420, 421, 496, 497, 571, 572, 653, 654, 728, 729, 802, 803, 877, 951, 1028, 1103, 1179, 1253, 1330, 1407, 1484, 1560, 1636, 1710, 1711, 1784, 1859, 1860, 1934, 1935, 2008, 2009, 2084, 2085, 2158, 2232, 2233, 2307, 2308, 2393, 2394, 2395, 2396, 2397, 2398, 2461, 2537, 2538, 2614, 2615, 2691, 2692, 2768, 2769, 2845, 2846, 2921, 2922, 2997, 2998, 3073, 3074, 3144, 3145, 3226, 3227, 3303, 3304, 3379, 3380, 3455, 3456, 3531, 3607, 3683, 3759, 3835, 3911, 4948, 4949, 4954, 4955, 4956, 4957, 4961, 4965, 4966, 4967, 4971, 4972, 4976, 4994, 4995, 4996, 4997, 4998, 4999, 5024, 5025, 5026, 5027, 5028, and 5029; or SEQ ID NOs: 95, 159, 162, 163, 164, 165, 347, 422, 498, 573, 953, 1030, 1105, 1255, 1332, 1409, 1486, 1562, 2309, 2463, 2540, 2617, 2694, 2771, 2848, 2924, 3000, 3076, 3147, 3229, 3306, 3382, 3457, 3533, 3609, 3685, 3761, 3837, 3913, 5000, 5001, 5002, 5003, 5004, 5005, 5006, 5031, 5032, 5033, 5034, 5035, 5036, and 5037.
Embodiment 6. The oligomeric compound of any of embodiments 1-5, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to the nucleobase sequence of any one of SEQ ID NOS: 1-4 when measured across the entire nucleobase sequence of the modified oligonucleotide.
Embodiment 7. The oligomeric compound of any of embodiments 1-6, wherein the modified oligonucleotide comprises at least one modified nucleoside.
Embodiment 8. The oligomeric compound of embodiment 7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
Embodiment 9. The oligomeric compound of embodiment 8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
Embodiment 10. The oligomeric compound of embodiment 9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2′-4′ bridge, wherein the 2′-4′ bridge is selected from —O—CH2—; and —O—CH(CH3)—.
Embodiment 11. The oligomeric compound of any of embodiments 8-10, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.
Embodiment 12. The oligomeric compound of embodiment 11, wherein the non-bicyclic modified sugar moiety is a 2′-MOE sugar moiety or 2′-OMe sugar moiety.
Embodiment 13. The oligomeric compound of any of embodiments 7-8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
Embodiment 14. The oligomeric compound of any of embodiments 1-13, wherein the modified oligonucleotide is a gapmer.
Embodiment 15. The oligomeric compound of any of embodiments 1-14, wherein the modified oligonucleotide has a sugar motif comprising: a 5′-region consisting of 1-6 linked 5′-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3′-region consisting of 1-6 linked 3′-region nucleosides, wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
Embodiment 16. The oligomeric compound of embodiment 15, wherein the 5′-region consists of 3 linked 5′-region nucleosides; the central region consists of 10 linked central region nucleosides; and the 3′-region consists of 3 linked 3′-region nucleosides, and wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a cEt modified sugar moiety.
Embodiment 17. The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
Embodiment 18. The oligomeric compound of embodiment 17, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
Embodiment 19. The oligomeric compound of embodiment 17 or 18, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
Embodiment 20. The oligomeric compound of embodiment 17 or 18, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.
Embodiment 21. The oligomeric compound of embodiment 17, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.
Embodiment 22. The oligomeric compound of any of embodiments 1-21, wherein the modified oligonucleotide comprises a modified nucleobase.
Embodiment 23. The oligomeric compound of embodiment 22, wherein the modified nucleobase is a 5-methyl cytosine.
Embodiment 24. The oligomeric compound of any of embodiments 1-23, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20,14-18, 14-20, 15-17, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.
Embodiment 25. The oligomeric compound of any of embodiments 1-23, wherein the modified oligonucleotide consists of 16 linked nucleosides.
Embodiment 26. The oligomeric compound of any of embodiments 1-25, consisting of the modified oligonucleotide.
Embodiment 27. The oligomeric compound of any of embodiments 1-25, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.
Embodiment 28. The oligomeric compound of embodiment 27, wherein the conjugate linker consists of a single bond.
Embodiment 29. The oligomeric compound of embodiment 27, wherein the conjugate linker is cleavable.
Embodiment 30. The oligomeric compound of embodiment 27, wherein the conjugate linker comprises 1-3 linker-nucleosides.
Embodiment 31. The oligomeric compound of 27, wherein the oligomeric compound does not comprise a linker-nucleoside.
Embodiment 32. The oligomeric compound of any of embodiments 28-31, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide.
Embodiment 33. The oligomeric compound of any of embodiments 28-31, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.
Embodiment 34. The oligomeric compound of any of embodiments 1-33, comprising a terminal group.
Embodiment 35. The oligomeric compound of any one of embodiments 1-34, wherein the conjugate group comprises a GalNAc moiety.
Embodiment 36. The oligomeric compound of anyone of embodiments 1-35, wherein the conjugate group comprises a cell-targeting moiety, a conjugate linker and a cleavable moiety, and wherein the cell-targeting moiety and the conjugate linker together have the following chemical structure:

Embodiment 37. The oligomeric compound of any of embodiments 1-36, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide.
Embodiment 38. An oligomeric compound according to the following chemical structure:

(SEQ ID NO: 3379), or a salt thereof.
Embodiment 39. The oligomeric compound of embodiment 38, which is the sodium salt or the potassium salt.
Embodiment 40. An oligomeric compound according to the following chemical structure:

(SEQ ID NO: 3379).
Embodiment 41. An oligomeric compound according to the following chemical structure:

(SEQ ID NO: 5006), or a salt thereof.

Embodiment 42. The oligomeric compound of embodiment 41, which is the sodium salt or the potassium salt.

Embodiment 43. An oligomeric compound according to the following chemical structure:

(SEQ ID NO: 5006).
Embodiment 44. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: (THA-GalNAc3)o Gks mCks Gks Gds Ads Ads Tds mCds Ads mCds mCds Ads Ads Gks Gks Ak (SEQ ID NO: 3379), wherein:

    • A=an adenine nucleobase,
    • mC=a 5-methyl cytosine nucleobase,
    • G=a guanine nucleobase,
    • T=a thymine nucleobase,
    • k=a cEt modified sugar moiety,
    • d=a 2′-β-D-deoxyribosyl sugar moiety,
    • o=a phosphodiester linkage, and
    • s=a phosphorothioate internucleoside linkage.
      Embodiment 45. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: (THA-GalNAc3)o Gks mCks Aks mCds Ums Tds Tds Ads Tds Tds Gds Ads Gds Tks Tks mCk (SEQ ID NO: 5006), wherein: A=an adenine nucleobase, mC=a 5-methyl cytosine nucleobase, G=a guanine nucleobase, T=a thymine nucleobase, U=a uracil nucleobase, k=a cEt modified sugar moiety, d=a 2′-β-D-deoxyribosyl sugar moiety, o=a phosphodiester linkage, and s=a phosphorothioate internucleoside linkage.
      Embodiment 46. An oligomeric duplex comprising the oligomeric compound of any of embodiments 1-36.
      Embodiment 47. An antisense compound comprising or consisting of an oligomeric compound of any of embodiments 1-45 or an oligomeric duplex of embodiment 46.
      Embodiment 48. A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-45, an oligomeric duplex of embodiment 46, or an antisense compound of embodiment 47; and a pharmaceutically acceptable carrier or diluent.
      Embodiment 49. The pharmaceutical composition of embodiment 48, wherein the pharmaceutically acceptable diluent is phosphate buffered saline.
      Embodiment 50. The pharmaceutical composition of embodiment 49, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate buffered saline.
      Embodiment 50. A method comprising administering to a subject a pharmaceutical composition of any of embodiments 48-50.
      Embodiment 51. A method of ameliorating or preventing a thromboembolic condition, comprising administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition according to any of embodiments 48-50.
      Embodiment 51. The method of embodiment 52, wherein the thromboembolic condition is selected from myocardial infarction (MI), stroke, limb ischemia and necrosis, venous thromboembolism (VTE), deep vein thrombosis (DVT), and pulmonary embolism (PE).
      Embodiment 53. The method of any of embodiments 51-53, wherein at least one symptom of the thromboembolic condition is ameliorated.
      Embodiment 54. The method of embodiment 54, wherein the symptom is pain, shortness of breath, heart burn, cold sweat, fatigue, lightheadedness, dizziness, swelling, cramping, and death.
      Embodiment 55. The method of any one of embodiments 51-55, comprising identifying the subject as having the thromboembolic condition or as having a risk factor for having the thromboembolic condition.
      Embodiment 56. The method of embodiment 56, wherein the risk factor is surgery, malignancy, pregnancy, aging, use of oral contraceptives, immobility, sepsis, a mechanical heart valve, valvular heart disease, atrial fibrillation, atherosclerosis, antiphospholipid syndrome, an inherited clotting disorder, or an acquired prothrombotic clotting disorder.
      Embodiment 57. A method of ameliorating or preventing hereditary angioedema, comprising administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition according to any of embodiments 48-50.
      Embodiment 58. A chirally enriched population of oligomeric compounds of any of embodiments 1-45, wherein the population is enriched for oligomeric compounds comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.
      Embodiment 59. The chirally enriched population of embodiment 59, wherein the population is enriched for oligomeric compounds comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.
      Embodiment 60. The chirally enriched population of embodiment 59, wherein the population is enriched for oligomeric compounds comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.
      Embodiment 61. The chirally enriched population of embodiment 59, wherein the population is enriched for oligomeric compounds having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
      Embodiment 62. The chirally enriched population of embodiment 62, wherein the population is enriched for oligomeric compounds having the (Sp) configuration at each phosphorothioate internucleoside linkage.
      Embodiment 63. The chirally enriched population of embodiment 62, wherein the population is enriched for oligomeric compounds having the (Rp) configuration at each phosphorothioate internucleoside linkage.
      Embodiment 64. The chirally enriched population of embodiment 62, wherein the population is enriched for oligomeric compounds having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.
      Embodiment 65. The chirally enriched population of embodiment 59 or embodiment 62, wherein the population is enriched for oligomeric compounds having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction.
      Embodiment 66. A chirally enriched population of oligomeric compounds of any of embodiments 1-45, wherein all of the phosphorothioate internucleoside linkages of the oligomeric compounds are stereorandom.

I. Certain Oligonucleotides

In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.

A. Certain Modified Nucleosides

Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

1. Certain Sugar Moieties

In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH3 (“OMe” or “O-methyl”), and 2′-O(CH2)2OCH3 (“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O—C1-C10 alkoxy, O—C1-C10 substituted alkoxy, O—C1-C10 alkyl, O—C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(═O)—N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.

In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH═CH2, OCH2CH═CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(═O)—N(Rm)(Rn)), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl.

In certain embodiments, a 2′-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(═O)—N(H)CH3 (“NMA”).

In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH3, and OCH2CH2OCH3.

Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4′-CH2—O-2′ (“LNA”), 4′-CH2—S-2′, 4′-(CH2)2—O-2′ (“ENA”), 4′-CH(CH3)—O-2′ (referred to as “constrained ethyl” or “cEt”), 4′-CH2—O—CH2-2′, 4′-CH2—N(R)-2′, 4′-CH(CH2OCH3)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH3)(CH3)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH2—N(OCH3)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH2—O—N(CH3)-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH2—C(H)(CH3)-2′ (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH2—C(═CH2)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(RaRb)—N(R)—O-2′, 4′-C(RaRb)—O—N(R)-2′, 4′-CH2—O—N(R)-2′, and 4′-CH2—N(R)—O- 2′, wherein each R, Ra, and Rb is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).

In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(Ra)(Rb)]n—, —[C(Ra)(Rb)]n—O—, —C(Ra)═C(Rb)—, —C(Ra)═N—, —C(═NRa)—, —C(═O)—, —C(═S)—, —O—, —Si(Ra)2—, —S(═O)x—, and —N(Ra)—;

    • wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O)2-J1), or sulfoxyl (S(═O)-J1); and
    • each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Wengel et a., U.S. Pat. No. 7,053,207; Imanishi et al., U.S. Pat. No. 6,268,490; Imanishi et al. U.S. Pat. No. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499; Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133; Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; Ramasamy et al., U.S. Pat. No. 6,525,191; Torsten et al., WO 2004/106356; Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; and U.S. Patent Publication Nos. Allerson et al., US2008/0039618 and Migawa et al., US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.

α-L-methyleneoxy (4′-CH2—O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).

In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.

In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, C J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

(“F-HNA”, see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

wherein, independently, for each of said modified THP nucleoside:

    • Bx is a nucleobase moiety;
    • T3 and T4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group;
      q1, q2, q3, q4, q5, q6 and q7 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and
    • each of R1 and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(═X)J1, OC(═X)NJ1J2, NJ3C(═X)NJ1J2, and CN, wherein X is O, S or NJ1, and each J1, J2, and J3 is, independently, H or C1-C6 alkyl.

In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6 and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”

In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.

Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

2. Certain Modified Nucleobases

In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that does not comprise a nucleobase, referred to as an abasic nucleoside.

In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

3. Certain Modified Internucleoside Linkages

In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphodiesters, which contain a phosphodiester bond (“P(O2)═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates, and phosphorodithioates. Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH2—N(CH3)—O—CH2—), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH2—O—); and N,N′-dimethylhydrazine (—CH2—N(CH3)—N(CH3)—). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH2—N(CH3)—O-5′), amide-3 (3′-CH2—C(═O)—N(H)-5′), amide-4 (3′-CH2—N(H)—C(═O)-5′), formacetal (3′-O—CH2—O-5′), methoxypropyl (MOP), and thioformacetal (3′-S—CH2—O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

B. Certain Motifs

In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

1. Certain Sugar Motifs

In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or portion thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

In certain embodiments, modified oligonucleotides have a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).

In certain embodiments, the wings of a gapmer comprise 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety.

In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.

In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing/gap junction comprise 2′-β-D-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties. In certain embodiments, each nucleoside of the gap comprises a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2′-β-D-deoxyribosyl sugar moiety.

In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2′-modification.

Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]-[# of nucleosides in the gap]-[# of nucleosides in the 3′-wing]. Thus, a 3-10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise 2′-β-D-deoxyribosyl sugar moieties. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2′-MOE nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 5 linked 2′-MOE nucleosides in the 3′-wing. A 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3′-wing. A 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5′-wing, 8 linked 2′-β-D-deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3′-wing. A 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5′- and/or the 3′-wing.

In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-10-6 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-10-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-8-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-8-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-8-6 MOE gapmers. In certain embodiments, modified oligonucleotides are X-Y-Z MOE gapmers, wherein X and Z are independently selected from 1, 2, 3, 4, 5, or 6 and Y is 7, 8, 9, 10, or 11.

2. Certain Nucleobase Motifs

In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.

In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.

3. Certain Internucleoside Linkage Motifs

In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P(O2)═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P(O2)═S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

In certain embodiments, modified nucleotides have an internucleoside linkage motif of soooossssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooooossssssssssoss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of soooosssssssssoss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooosssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooossssssssssoooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of soosssssssssoooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.

C. Certain Lengths

It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.

In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

D. Certain Modified Oligonucleotides

In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.

E. Certain Populations of Modified Oligonucleotides

Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for R-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.

F. Nucleobase Sequence

In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a portion of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a portion or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.

II. Certain Oligomeric Compounds

In certain embodiments, provided herein are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.

Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

A. Certain Conjugate Groups

In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmaco*kinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

1. Conjugate Moieties

Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

2. Conjugate Linkers

Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circ*mstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

In certain embodiments, a cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, and a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate or phosphodiester linkage between an oligonucleotide and a conjugate moiety or conjugate group.

In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxynucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphodiester internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.

3. Cell-Targeting Moieties

In certain embodiments, a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate group has the general formula:

wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.

In certain embodiments, the cell-targeting moiety comprises a branching group comprising one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain embodiments, the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl and ether groups. In certain embodiments, the branching group comprises a mono or polycyclic ring system.

In certain embodiments, each tether of a cell-targeting moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amid, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group. In certain embodiments, each tether comprises a chain from about 6 to about 20 atoms in length. In certain embodiments, each tether comprises a chain from about 10 to about 18 atoms in length. In certain embodiments, each tether comprises about 10 atoms in chain length.

In certain embodiments, each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, each ligand has an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is, independently selected from galactose, N-acetyl galactosamine (GalNAc), mannose, glucose, glucosamine and fucose. In certain embodiments, each ligand is N-acetyl galactosamine (GalNAc). In certain embodiments, the cell-targeting moiety comprises 3 GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises 2 GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises 1 GalNAc ligand.

In certain embodiments, each ligand of a cell-targeting moiety is a carbohydrate, carbohydrate derivative, modified carbohydrate, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain such embodiments, the conjugate group comprises a carbohydrate cluster (see, e.g., Maier et al., “Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting,” Bioconjugate Chemistry, 2003, 14, 18-29, or Rensen et al., “Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor,” J. Med. Chem. 2004, 47, 5798-5808, which are incorporated herein by reference in their entirety). In certain such embodiments, each ligand is an amino sugar or a thio sugar. For example, amino sugars may be selected from any number of compounds known in the art, such as sialic acid, α-D-galactosamine, β-muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose and N-sulfo-D-glucosamine, and N-glycoloyl-α-neuraminic acid. For example, thio sugars may be selected from 5-Thio-β-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside.

In certain embodiments, conjugate groups comprise a cell-targeting moiety having the formula:

In certain embodiments, conjugate groups comprise a cell-targeting moiety having the formula:

In certain embodiments, conjugate groups comprise a cell-targeting moiety having the formula:

In certain embodiments, compounds described herein comprise a conjugate group described herein as “THA-GalNAac3”. THA-GalNAc3 is shown below without the optional cleavable moiety at the end of the linker region:

In certain embodiments, compounds described herein comprise THA-GalNAc3-phosphate, also represented as (THA-GalNAc3)o, having the formula:

wherein modified oligonucleotide represents a modified oligonucleotide.

In certain embodiments, compounds described herein comprise a 3′-THA-C6-GalNAc hydroxyproline phosphate, (“HPPO-GalNAc”). 3′-HPPO-GalNAc is represented by the structure below wherein the phosphate group is attached to the 3′-oxygen atom of the 3′ nucleoside:

Representative publications that teach the preparation of certain of the above noted conjugate groups and compounds comprising conjugate groups, tethers, conjugate linkers, branching groups, ligands, cleavable moieties as well as other modifications include without limitation, U.S. Pat. Nos. 5,994,517, 6,300,319, 6,660,720, 6,906,182, 7,262,177, 7,491,805, 8,106,022, 7,723,509, 9,127,276, US 2006/0148740, US 2011/0123520, WO 2013/033230 and WO 2012/037254, Biessen et al., J. Med. Chem. 1995, 38, 1846-1852, Lee et al., Bioorganic & Medicinal Chemistry 2011, 19, 2494-2500, Rensen et al., J. Biol. Chem. 2001, 276, 37577-37584, Rensen et al., J. Med. Chem. 2004, 47, 5798-5808, Sliedregt et al., J. Med. Chem. 1999, 42, 609-618, and Valentijn et al., Tetrahedron, 1997, 53, 759-770, each of which is incorporated by reference herein in its entirety.

In certain embodiments, compounds described herein comprise modified oligonucleotides comprising a gapmer or fully modified motif and a conjugate group comprising at least one, two, or three GalNAc ligands. In certain embodiments compounds described herein comprise a conjugate group found in any of the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et al., Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycobiol, 2001, 11, 821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38-43; Westerlind et al., Glycoconj J, 2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg Med Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500; Kornilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47, 5798-5808; Rensen et al., Arterioscler Thromb Vasc Biol, 2006, 26, 169-175; van Rossenberg et al., Gene Ther, 2004, 11, 457-464; Sato et al., J Am Chem Soc, 2004, 126, 14013-14022; Lee et al., J Org Chem, 2012, 77, 7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940; Duff et al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003, 14, 18-29; Jayaprakash et al., Org Lett, 2010, 12, 5410-5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; International applications WO1998/013381; WO2011/038356; WO1997/046098; WO2008/098788; WO2004/101619; WO2012/037254; WO2011/120053; WO2011/100131; WO2011/163121; WO2012/177947; WO2013/033230; WO2013/075035; WO2012/083185; WO2012/083046; WO2009/082607; WO2009/134487; WO2010/144740; WO2010/148013; WO1997/020563; WO2010/088537; WO2002/043771; WO2010/129709; WO2012/068187; WO2009/126933; WO2004/024757; WO2010/054406; WO2012/089352; WO2012/089602; WO2013/166121; WO2013/165816; U.S. Pat. Nos. 4,751,219; 8,552,163; 6,908,903; 7,262,177; 5,994,517; 6,300,319; 8,106,022; 7,491,805; 7,491,805; 7,582,744; 8,137,695; 6,383,812; 6,525,031; 6,660,720; 7,723,509; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent Application Publications US2011/0097264; US2011/0097265; US2013/0004427; US2005/0164235; US2006/0148740; US2008/0281044; US2010/0240730; US2003/0119724; US2006/0183886; US2008/0206869; US2011/0269814; US2009/0286973; US2011/0207799; US2012/0136042; US2012/0165393; US2008/0281041; US2009/0203135; US2012/0035115; US2012/0095075; US2012/0101148; US2012/0128760; US2012/0157509; US2012/0230938; US2013/0109817; US2013/0121954; US2013/0178512; US2013/0236968; US2011/0123520; US2003/0077829; US2008/0108801; and US2009/0203132; each of which is incorporated by reference in its entirety.

B. Certain Terminal Groups

In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5′-phosphate. Stabilized 5′-phosphates include, but are not limited to 5′-phosphinates, including, but not limited to 5′-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2′-linked nucleosides. In certain such embodiments, the 2′-linked nucleoside is an abasic nucleoside.

III. Oligomeric Duplexes

In certain embodiments, oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes comprise a first oligomeric compound having a portion complementary to a target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group. The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.

IV. Antisense Activity

In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.

In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.

V. Certain Target Nucleic Acids

In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA, and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an antisense transcript. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is the RNA transcriptional product of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.

A. Complementarity/Mismatches to the Target Nucleic Acid

It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.

In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a portion that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the portion of full complementarity is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases in length.

In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing region.

B. FXII

In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide, or portion thereof, that is complementary to a target nucleic acid, wherein the target nucleic acid is a FXII nucleic acid. In certain embodiments, the FXII nucleic acid has the human FXII mRNA sequence designated herein as SEQ ID NO: 1 (ENSEMBL ID ENST00000253496.3 from ENSEMBL version 99: January 2020). In certain embodiments, the FXII nucleic acid has the human F12 genomic sequence, designated herein as SEQ ID NO: 2 (ENSEMBL ID ENSG00000131187.9 from ENSEML version 99: January 2020, human reference assembly version GRCh38.p13 located on the reverse strand of chromosome 5 from positions 177,402,140 to 177,409,576). In certain embodiments, the FXII nucleic acid has the human F12 genomic sequence, designated herein as SEQ ID NO. 3 (the complement of GENBANK Accession No. NC_000005.10 truncated from truncated from nucleotides 177399001 to 177413000). In certain embodiments, the FXII nucleic acid has the human FXII mRNA sequence designated herein as SEQ ID NO: 4 (GENBANK Accession No. NM_000505.3).

In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOS: 1-4 is capable of reducing FXII RNA in a cell. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOS: 1-4 is capable of reducing FXII protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOS: 1-4 is capable of ameliorating one or more symptoms of a thromboembolic condition when administered to a subject. In certain embodiments, the thromboembolic condition is deep vein thrombosis, venous thrombosis, arterial thrombosis, pulmonary embolism, myocardial infarction, or stroke. In certain embodiments, the symptoms are selected from pain, shortness of breath, heart burn, cold sweat, fatigue, lightheadedness, dizziness, swelling, cramping, and death.

In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOS: 1-4 is capable of reducing the detectable amount of FXII RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOS: 1-4 is capable of reducing the detectable amount of FXII protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOS: 1-4 is capable of reducing the detectable amount of FXII RNA in a biological sample of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOS: 1-4 is capable of reducing the detectable amount of FXII protein in a biological sample of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, the biological sample comprises blood, plasma/serum, or a cell of the subject.

VI. Certain Pharmaceutical Compositions

In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.

Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.

In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.

In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.

VII. Certain Compositions

1. Compound No. 1194357

In certain embodiments, Compound No. 1194357 is characterized as an oligomeric compound consisting of a conjugate group and a modified oligonucleotide, wherein the conjugate group is a THA-GalNAc3 that is directly attached to the 5′ end of the modified oligonucleotide through a phosphodiester linkage, (THA-GalNAc3)o; wherein (THA-GalNAc3)o is represented by the following structure:

wherein the modified oligonucleotide is a 3-10-3 cEt gapmer, having a sequence of (from 5′ to 3′) GCGGAATCACCAAGGA (incorporated herein as SEQ ID NO: 3379); wherein each of nucleosides 1-3 and 14-16 (from 5′ to 3′) comprise a cEt modified sugar moiety and each of nucleosides 4-13 are 2′-β-D-deoxynucleosides; wherein each internucleoside linkage is a phosphorothioate internucleoside linkage; and wherein each cytosine is a 5-methyl cytosine.

In certain embodiments, Compound No. 1194357 is represented by the following chemical notation: (THA-GalNAc3)o Gks mCks Gks Gds Ads Ads Tds mCds Ads mCds mCds Ads Ads Gks Gks Ak, wherein:

    • A=an adenine nucleobase,
    • mC=a 5-methyl cytosine nucleobase,
    • G=a guanine nucleobase,
    • T=a thymine nucleobase,
    • k=a cEt modified sugar moiety,
    • d=a 2′-β-D-deoxyribosyl sugar moiety, and
    • s=a phosphorothioate internucleoside linkage.

In certain embodiments, provided is an oligomeric compound comprising a modified oligonucleotide and a conjugate group according to the following chemical notation: (THA-GalNAc3)o Gks mCks Gks Gds Ads Ads Tds mCds Ads mCds mCds Ads Ads Gks Gks Ak, wherein:

    • A=an adenine nucleobase,
    • mC=a 5-methyl cytosine nucleobase,
    • G=a guanine nucleobase,
    • T=a thymine nucleobase,
    • k=a cEt modified sugar moiety,
    • d=a 2′-β-D-deoxyribosyl sugar moiety, and
    • s=a phosphorothioate internucleoside linkage;
      and wherein (THA-GalNAc3)o=

In certain embodiments, Compound No. 1194357 is represented by the following chemical structure:

(SEQ ID NO: 3379). Structure 1. Compound No. 1194357

In certain embodiments, the sodium salt of Compound No. 1194357 is represented by the following chemical structure:

(SEQ ID NO: 3379). Structure 2. The sodium salt of Compound No. 1194357

2. Compound No. 1270705

In certain embodiments, Compound No. 1270705 is characterized as an oligomeric compound consisting of a conjugate group and a modified oligonucleotide; wherein the conjugate group is a THA-GalNAc3 that is directly attached to the 5′ end of the modified oligonucleotide through a phosphodiester linkage, (THA-GalNAc3)o; wherein (THA-GalNAc3)o is represented by the following structure:

wherein the modified oligonucleotide is gapmer, having a sequence of (from 5′ to 3′) GCACUTTATTGAGTTC (incorporated herein as SEQ ID NO: 5006); wherein each of nucleosides 1-3 and 14-16 (from 5′ to 3′) comprise a cEt modified sugar moiety, each of nucleosides 4 and 6-13 are 2′-β-D-deoxynucleosides, and nucleoside 5 comprises a 2′-O-methyl sugar moiety; wherein each internucleoside linkage is a phosphorothioate internucleoside linkage, and wherein each cytosine is a 5-methyl cytosine.

In certain embodiments, Compound No. 1270705 is represented by the following chemical notation: (THA-GalNAc3)o Gks mCks Aks mCds Uys Tds Tds Ads Tds Tds Gds Ads Gds Tks Tks mCk, wherein:

    • A=an adenine nucleobase,
    • mC=a 5-methyl cytosine nucleobase,
    • G=a guanine nucleobase,
    • T=a thymine nucleobase,
    • U=a uracil nucleobase,
    • k=a cEt modified sugar moiety,
    • y=a 2′-O-methyl modified ribosyl sugar moiety,
    • d=a 2′-β-D-deoxyribosyl sugar moiety, and
    • s=a phosphorothioate internucleoside linkage.

In certain embodiments, provided is an oligomeric compound comprising a modified oligonucleotide and a conjugate group according to the following chemical notation: (THA-GalNAc3)o Gks mCks Aks mCds Uys Tds Tds Ads Tds Tds Gds Ads Gds Tks Tks mCk, wherein:

    • A=an adenine nucleobase,
    • mC=a 5-methyl cytosine nucleobase,
    • G=a guanine nucleobase,
    • T=a thymine nucleobase,
    • U=a uracil nucleobase,
    • k=a cEt modified sugar moiety,
    • y=a 2′-O-methyl modified ribosyl sugar moiety,
    • d=a 2′-β-D-deoxyribosyl sugar moiety, and
    • s=a phosphorothioate internucleoside linkage;
      and wherein (THA-GalNAc3)o=

In certain embodiments, Compound No. 1270705 is represented by the following chemical structure:

(SEQ ID NO: 5006).
Structure 3. Compound No. 1270705

In certain embodiments, the sodium salt of Compound No. 1270705 is represented by the following chemical structure:

(SEQ ID NO: 5006).
Structure 4. The sodium salt of Compound No. 1270705
VIII. Certain Comparator Compounds

Comparator Compound Nos. 1213029, 1213030, 1213034, and 1358035 (relating to Compound Nos. A-145667, A-145668, A-145676, and A-145669, respectively) were selected as comparator compounds from Example 1 of WO2017/120397 (incorporated herein by reference).

In certain embodiments, Compound No. 1213029, a surrogate of which (Compound A-145667) is provided in WO2017/120397, was used as a comparator compound, see Example 14. Compound No. 1213029 is a gapmer having a sugar motif of (from 5′ to 3′) yyyyyddddddddddyyyyy, wherein each “y” represents a 2′-O-methyl sugar moiety and each “d” represents a 2′-β-D-deoxyribosyl sugar moiety; having a sequence of (from 5′ to 3′) GAAUACCAAGGAGGGAAAG (SEQ ID NO: 5042), wherein each “C” of the gap is a 5-methyl cytosine; and wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, Compound No. 1213030, a surrogate of which (Compound A-145668) is provided in WO2017/120397, was used as a comparator compound, see Example 14. Compound No. 1213030 is a gapmer having a sugar motif of (from 5′ to 3′) yyyyyddddddddddyyyyy, wherein each “y” represents a 2′-O-methyl sugar moiety and each “d” represents a 2′-β-D-deoxyribosyl sugar moiety; having a sequence of (from 5′ to 3′) UCUCACTGCGGAATCACCAA (SEQ ID NO: 5041), wherein each “C” of the gap is a 5-methyl cytosine; and wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, Compound No. 1213034, a surrogate of which (Compound A-145676) is provided in WO2017/120397, was used as a comparator compound, see Example 14. Compound No. 1213034 is a gapmer having a sugar motif of (from 5′ to 3′) yyyyyddddddddddyyyyy, wherein each “y” represents a 2′-O-methyl sugar moiety and each “d” represents a 2′-β-D-deoxyribosyl sugar moiety; having a sequence of (from 5′ to 3′) CACUUTATTGAGTTCCUGCG (SEQ ID NO: 5039), wherein each “C” of the gap is a 5-methyl cytosine; and wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, Compound No. 1358035, a surrogate of which (Compound A-145669) is provided in WO2017/120397, was used as a comparator compound, see Example 14. Compound No. 1358035 is a gapmer having a sugar motif of (from 5′ to 3′) yyyyyddddddddddyyyyy, wherein each “y” represents a 2′-O-methyl sugar moiety and each “d” represents a 2′-β-D-deoxyribosyl sugar moiety; having a sequence of (from 5′ to 3′) CCCCAGCCACTCTCTCACUG (SEQ ID NO: 5040), wherein each “C” of the gap is a 5-methyl cytosine; and wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, compounds described herein are superior relative to comparator compounds described in WO2017/120397 because they demonstrate one or more improved properties, such as in vitro activity.

For example, as described herein, certain compounds, including Compound No. 1129485 and Compound No. 1213144, achieved IC50 values of 0.34 and 0.28, respectively, whereas each of comparator compounds Compound No. 1213029, Compound No. 1213030, Compound No. 1213034, and Compound No. 1358035 achieved IC50 values of >10, 8.15, >10, and 8.59, respectively, (see Table 154 in Example 14 for IC50 values). Therefore, certain compounds described herein are more potent than comparator compounds Compound No. 1213029, Compound No. 1213030, Compound No. 1213034, and Compound No. 1358035 in a multiple dose assay.

Compound No. 1194357 is identical to Compound No. 1129485, with the exception that Compound No. 1194357 comprises a conjugate group, and Compound No. 1270705 is identical to Compound No. 1213144, with the exception that Compound No. 1270705 comprises a conjugate group. Therefore, unconjugated versions of Compound No. 1129485 and Compound No. 1270705 are more active than comparator compounds Compound No. 1213029, Compound No. 1213030, Compound No. 1213034, and Compound No. 1358035 in a multiple dose assay.

IX. Certain Hotspot Regions

In certain embodiments, nucleobases in the ranges specified below comprise a hotspot region of FXII nucleic acid. In certain embodiments, modified oligonucleotides that are complementary to a hotspot region of a FXII nucleic acid achieve an average of more than 50% reduction of FXII RNA in vitro in a standard cell assay.

1. Nucleobases 1,899-1,979 of SEO ID NO: 1

In certain embodiments, nucleobases 1,899-1,979 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 1,899-1,979 of SEQ ID NO: 1. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

The nucleobase sequences of SEQ ID NOs: 92, 156, 270, 271, 345, 346, 420, 421, 496, 497, 571, 572, 653, 654, 728, 729, 802, 803, 877, 951, 1028, 1103, 1179, 1253, 1330, 1407, 1484, 1560, 1636, 1710, 1711, 1784, 1859, 1860, 1934, 1935, 2008, 2009, 2084, 2085, 2158, 2232, 2233, 2307, 2308, 2393, 2394, 2395, 2396, 2397, 2398, 2461, 2537, 2538, 2614, 2615, 2691, 2692, 2768, 2769, 2845, 2846, 2921, 2922, 2997, 2998, 3073, 3074, 3144, 3145, 3226, 3227, 3303, 3304, 3379, 3380, 3455, 3456, 3531, 3607, 3683, 3759, 3835, 3911, 4948, 4949, 4954, 4955, 4956, 4957, 4961, 4965, 4966, 4967, 4971, 4972, 4976, 4994, 4995, 4996, 4997, 4998, 4999, 5024, 5025, 5026, 5027, 5028, and 5029 are complementary to nucleobases 1,899-1,979 of SEQ ID NO: 1.

The nucleobase sequences of Compound Nos: 1125047, 1125048, 1125049, 1125050, 1125051, 1125074, 1125075, 1125076, 1125077, 1125078, 1129474, 1129475, 1129476, 1129477, 1129478, 1129479, 1129480, 1129481, 1129482, 1129483, 1129484, 1129485, 1129486, 1129487, 1129488, 1129489, 1129490, 1129491, 1129492, 1129493, 1129494, 1129495, 1129496, 1129497, 1129498, 1129499, 1129500, 1129501, 1129502, 1129503, 1129504, 1129505, 1129506, 1131681, 1131682, 1131683, 1131684, 1131685, 1131686, 1131687, 1131688, 1131689, 1131690, 1131691, 1131692, 1131693, 1131694, 1131695, 1131696, 1131697, 1131698, 1131699, 1131700, 1131701, 1131702, 1131703, 1131704, 1131705, 1131706, 1131707, 1131708, 1131709, 1131710, 1131711, 1131712, 1131713, 1131714, 1131715, 1131716, 1131717, 1131718, 1131719, 1131720, 1131721, 1131722, 1131723, 1131724, 1131725, 1206454, 1206455, 1206456, 1206457, 1206458, 1206459, 1206485, 1206486, 1206487, 1206488, 1206489, 1206490, 1206491, 1206492, 1206505, 1206506, 1206507, 1206508, 1206509, 1206957, 1206958, 1206959, 1206960, 1206961, 1206962, 1206963, 1206964, 1206965, 1206966, 1206967, 1206968, 1206969, 1206970, 1206971, 1206972, 1206973, 1206974, 1206975, 1206976, 1206977, 1206978, 1206979, 1206980, 1206981, 1206982, 1206983, 1206985, 1206986, 1206987, 1206988, 1207098, 1207099, 1207100, 1207101, 1207102, 1207103, 1207104, 1207105, 1207106, 1207107, 1207108, 1207109, 1207110, 1207111, 1207112, 1207113, 1207114, 1207115, 1207116, 1207117, 1207118, 1207120, 1207123, 1207125, 1207127, 1207129, 1207131, 1207133, 1207135, 1207137, 1207139, 1207141, 1207228, 1207229, 1207230, 1207231, 1207232, 1207233, 1207234, 1207235, 1207236, 1207237, 1207238, 1207239, 1207240, 1207241, 1207242, 1207243, 1207244, 1207245, 1207246, 1207247, 1207248, 1207249, 1207250, 1207251, 1207252, 1207253, 1207254, 1207256, 1207257, 1207258, 1207259, 1207345, 1207346, 1207347, 1207348, 1207349, 1207350, 1207351, 1207352, 1207353, 1207354, 1207355, 1207356, 1207357, 1207358, 1207359, 1207360, 1207361, 1207362, 1207363, 1207364, 1207365, 1207366, 1207367, 1207368, 1207369, 1207370, 1207371, 1207372, 1207373, 1207374, 1207375, 1207376, 1207462, 1207463, 1207464, 1207465, 1207466, 1207467, 1207468, 1207469, 1207470, 1207471, 1207472, 1207473, 1207474, 1207475, 1207476, 1207477, 1207478, 1207479, 1207480, 1207481, 1207482, 1207483, 1207484, 1207485, 1207486, 1207487, 1207488, 1207489, 1207490, 1207491, 1207492, 1207493, 1213094, 1213095, 1213096, 1213097, 1213098, 1213099, 1213100, 1213101, 1213102, 1213103, 1213104, 1213105, 1213106, 1213107, 1213108, 1213109, 1213110, 1213111, 1213112, 1213113, 1213114, 1213115, 1213116, 1213117, 1213118, 1213119, 1213120, 1213121, 1213122, 1213123, 1213124, 1213125, 1213211, 1213212, 1213213, 1213214, 1213215, 1213216, 1213217, 1213218, 1213219, 1213220, 1213221, 1213222, 1213223, 1213224, 1213225, 1213226, 1213227, 1213228, 1213229, 1213230, 1213231, 1213232, 1213233, 1213234, 1213235, 1213236, 1213237, 1213238, 1213239, 1213240, 1213241, and 1213242 are complementary to nucleobases 1,899-1,979 of SEQ ID NO: 1.

In certain embodiments, modified oligonucleotides complementary to nucleobases 1,899-1,979 of SEQ ID NO: 1 achieve an average of 78% reduction of F12 mRNA in vitro in the standard cell assay.

2. Nucleobases 2,004-2,045 of SEO ID NO: 1

In certain embodiments, nucleobases 2,004-2,045 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to nucleobases 2,004-2,045 of SEQ ID NO: 1.

The nucleobase sequences of SEQ ID NOs: 95, 159, 162, 163, 164, 165, 347, 422, 498, 573, 953, 1030, 1105, 1255, 1332, 1409, 1486, 1562, 2309, 2463, 2540, 2617, 2694, 2771, 2848, 2924, 3000, 3076, 3147, 3229, 3306, 3382, 3457, 3533, 3609, 3685, 3761, 3837, 3913, 5000, 5001, 5002, 5003, 5004, 5005, 5006, 5031, 5032, 5033, 5034, 5035, 5036, and 5037 are complementary to nucleobases 2,004-2,045 of SEQ ID NO: 1.

The modified oligonucleotides of Compound Nos: 462192, 1125101, 1125102, 1125103, 1125104, 1129526, 1129527, 1129528, 1129529, 1129530, 1129531, 1129532, 1129533, 1129534, 1129535, 1129536, 1129537, 1129538, 1129539, 1129540, 1129541, 1129542, 1129543, 1129544, 1129545, 1131745, 1131746, 1131747, 1131748, 1131749, 1131750, 1131751, 1131752, 1131753, 1131754, 1131755, 1131756, 1131757, 1131758, 1131759, 1131760, 1131761, 1131762, 1131763, 1206993, 1206994, 1206995, 1206996, 1206997, 1206998, 1206999, 1207000, 1207001, 1207002, 1207003, 1207004, 1207005, 1207006, 1207007, 1207008, 1207010, 1207011, 1207012, 1207147, 1207148, 1207149, 1207150, 1207151, 1207152, 1207153, 1207154, 1207155, 1207156, 1207157, 1207158, 1207159, 1207160, 1207161, 1207162, 1207163, 1207164, 1207165, 1207166, 1207264, 1207265, 1207266, 1207267, 1207268, 1207269, 1207270, 1207271, 1207272, 1207273, 1207274, 1207275, 1207276, 1207277, 1207278, 1207279, 1207280, 1207281, 1207282, 1207283, 1207381, 1207382, 1207383, 1207384, 1207385, 1207386, 1207387, 1207388, 1207389, 1207390, 1207391, 1207392, 1207393, 1207394, 1207395, 1207396, 1207397, 1207398, 1207399, 1207400, 1207498, 1207499, 1207500, 1207501, 1207502, 1207503, 1207504, 1207505, 1207506, 1207507, 1207508, 1207509, 1207511, 1207512, 1207513, 1207514, 1207515, 1207516, 1207517, 1213130, 1213131, 1213132, 1213133, 1213134, 1213135, 1213136, 1213137, 1213138, 1213139, 1213140, 1213141, 1213142, 1213143, 1213144, 1213145, 1213146, 1213147, 1213148, 1213149, 1213247, 1213248, 1213249, 1213250, 1213251, 1213252, 1213253, 1213254, 1213255, 1213256, 1213257, 1213258, 1213259, 1213260, 1213261, 1213262, 1213263, 1213264, 1213265, and 1213266 are complementary to nucleobases 2,004-2,045 of SEQ ID NO: 1.

In certain embodiments, modified oligonucleotides complementary to nucleobases 2,004-2,045 of SEQ ID NO: 1 achieve an average of 80% reduction of F12 mRNA in vitro in the standard cell assay.

X. Certain Indications

In certain embodiments, methods comprise administering a pharmaceutical composition described herein to a subject with a thromboembolic condition. Thromboembolic conditions include, but are not limited to, myocardial infarction (MI), stroke, limb ischemia and necrosis, and venous thromboembolism (VTE), including deep vein thrombosis (DVT) and pulmonary embolism (PE).

In certain embodiments, methods comprise administering a pharmaceutical composition described herein to a subject having a risk factor for developing a thromboembolic condition. In certain embodiments, the risk factor is genetic, health-associated, or environmental, or a combination thereof. In certain embodiments, the risk factor is surgery, malignancy, pregnancy, aging, use of oral contraceptives, immobility (including travel-related immobility), sepsis, having a mechanical heart valve, valvular heart disease, atrial fibrillation, atherosclerosis, antiphospholipid syndrome, an inherited clotting disorder (e.g., Factor V Leiden), or an acquired prothrombotic clotting disorder. Identifying a subject with a risk factor for developing a thromboembolic condition may be accomplished by evaluating a subject's medical history and/or by conducting standard clinical tests or assessments.

In certain embodiments, methods comprise administering a pharmaceutical composition described herein to a subject who has been identified as in need of anticoagulation therapy. Non-limiting examples of such subjects include a subject undergoing major orthopedic surgery (e.g., hip/knee replacement or hip fracture surgery) and a subject with atrial fibrillation.

Nonlimiting Disclosure and Incorporation by Reference

Each of the literature and patent publications listed herein is incorporated by reference in its entirety.

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.

Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH in place of one 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of an uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein mC indicates a cytosine base comprising a methyl group at the 5-position.

Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or R such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2H or 3H in place of 1H, 13C or 14C in place of 12C, 15N in place of 14N, 17O or 18O in place of 16O, and 33S, 34S, 35S, or 36S in place of 32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.

The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.

Modified oligonucleotides complementary to an FXII nucleic acid were synthesized and tested for their effect on FXII RNA levels in vitro. The modified oligonucleotides were tested in a series of experiments using culture conditions as indicated. The results for each separate experiment are presented in separate tables below.

The modified oligonucleotides in the tables below are 5-10-5 MOE gapmers (i.e., they have a central region of ten 2′-deoxynucleosides flanked on each side by wings, each comprising five 2′-MOE nucleosides). The motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. The internucleoside linkages throughout each modified oligonucleotide are phosphorothioate linkages. All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. “Stop site” indicates the 3′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are 100% complementary to one or more human FXII target sequences, including the human FXII mRNA sequence designated herein as SEQ ID NO: 1 (ENSEMBL ID ENST00000253496.3 from ENSEMBL version 99: January 2020), the human FXII genomic sequence, designated herein as SEQ ID NO: 2 (ENSEMBL ID ENSG00000131187.9 from ENSEML version 99: January 2020), the human FXII genomic sequence, designated herein as SEQ ID NO: 3 (the complement of GENBANK Accession No. NC_000005.10 truncated from truncated from nucleotides 177399001 to 177413000), and the human FXII mRNA sequence designated herein as SEQ ID NO: 4 (GENBANK Accession No. NM_000505.3). ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular target sequence with 100% complementarity.

Cultured Huh7 cells were transfected either with lipofectin, oligofectamine, or by electroporation, as indicated in the tables below. In some cases, Huh7 cells, at a density of 8,000 cells per well, were transfected using lipofectin with 120 nM modified oligonucleotide. In other cases, Huh7 cells, at a density of 5,000 cells per well, were transfected using oligofectamine with 200 nM modified oligonucleotide. In other cases, Huh7 cells, at a density of 20,000 cells per well, were transfected using electroporation with 5000 nM modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and FXII RNA levels were measured by quantitative real-time RTPCR. Either human primer probe set RTS2992 (forward sequence GTCAACACTTTCGATTCCACCTT, designated herein as SEQ ID NO: 5; reverse sequence TCCCCGGTGACAGTGAGAAC, designated herein as SEQ ID NO: 6; probe sequence AAGCCCCCAAGGAGCATAAGTACAAAGCTG, designated herein as SEQ ID NO: 7) or human primer probe set RTS40528 (forward sequence GTGCACGGATCCTCCATC, designated herein as SEQ ID NO: 8; reverse sequence CAGCTTGGTCCTCACACAC, designated herein as SEQ ID NO: 9; probe sequence AATCACCCTGGCACGCATCG, designated herein as SEQ ID NO: 10) was used to measure RNA levels. FXII RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of FXII RNA is presented in the tables below as percent FXII RNA relative to the amount in untreated control cells (% UTC). The symbol “” indicates that the modified oligonucleotide is complementary to the target transcript within the amplicon region of the primer probe set. In such instances, additional assays using alternative primer probes must be performed to accurately assess the potency and efficacy of such modified oligonucleotides.

TABLE 1
Reduction of FXII RNA by 5-10-5 MOE gapmers with full PS internucleoside
linkages (Huh7, lipofectin, 120 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
1122FXIISEQ
CompoundStartStopStartStop(% UTC)ID
NumberSiteSiteSiteSiteSequence (5' to 3')RTS2992NO
413577   1  20   1  20CCAGGAGTCCAGATCAATAG 6220
413578  67  86  67  86TCACCAGCAGGAACCCCAGG 2121
413579  92 111N/AN/AGGAATCGAAAGTGTTGACTC 1922
413580 159 178N/AN/AGGTGACAGTGAGAACGACTG  623
413581 164 18335153534TCCCCGGTGACAGTGAGAAC  324
413582 217 23635683587GGGTACATTTGTGGTACAGC 1925
413583 227 24635783597CGGCCCTTGTGGGTACATTT 3026
413584 237 25635883607AGGGCCTGGCCGGCCCTTGT 6727
413585 291 31037983817GTATCCCCATCGCTGGTCCT 1428
413586 325 344N/AN/ATGCAGTGGTCTTTCACTTTC 1929
413587 399 41842074226TTGTGGACAGAGACAGTGGG 2730
413588 409 42842174236CAGTGAGGTGTTGTGGACAG 1431
413589 452 47143974416AGAAGCTGAGGCTCAAAGCA 3832
413590 462 48144074426GAAAAACCGGAGAAGCTGAG 2433
413591 515 53444604479TGGCATCTGGCCACAGCTGC 2034
413592 520 53944654484TGCACTGGCATCTGGCCACA 3335
413593 528 54744734492AGGACCCTTGCACTGGCATC 2436
413594 538 55744834502AGTGGGCATCAGGACCCTTG 2237
413595 548 56744934512AGCCGCTGGCAGTGGGCATC 5738
413596 562 581N/AN/AAGGCCTGGCTGGCCAGCCGC11239
413597 567 586N/AN/AGCGGCAGGCCTGGCTGGCCA 3140
413598 572 591N/AN/ATTGGTGCGGCAGGCCTGGCT 4841
413599 587 60646714690CCATGGAGGCACGGGTTGGT 1942
413600 608 62746924711TCCACCTCTAGGCAGCGACC 1943
413601 626 64547104729TGGCACAGGCGGTGGCCCTC 3944
413602 695 71449244943CCGCGGCCATCATAGCAGCT 2445
413603 700 71949294948TGAGCCCGCGGCCATCATAG 3346
413604 705 72449344953GTAGCTGAGCCCGCGGCCAT 2847
413605 713 73249424961AGGCCGCGGTAGCTGAGCCC 3848
413606 718 73749474966TGGCCAGGCCGCGGTAGCTG 3049
413607 723 74249524971GGTCCTGGCCAGGCCGCGGT 2350
413608 746 76549754994TGACAGGGCGCACCCGAGAG 3351
413609 751 77049804999ACGGCTGACAGGGCGCACCC 2852
413610 808 82750375056GTCCCCAGTTCCGCGCTTGC 2153
413611 818 83750475066TGGCCGCCCAGTCCCCAGTT 2954
413612 839 858N/AN/ATCCGGGTTCCGGCAGAAGGC 2055
413613 863 88251775196AAGCACCACGGGCGGATGTC 2956
413614 871 89051855204TCAGCACGAAGCACCACGGG 1357
413615 978 99752925311CATGAGTGGGACATGAAGCC 3858
4136161119113855385557GAGCCGCTGCCCGCAGCTCA 3159
4136171132115155515570ACAGACTCTTGCGGAGCCGC 1960
4136181137115655565575CGAAGACAGACTCTTGCGGA 2261
4136191142116155615580GTCATCGAAGACAGACTCTT 2862
4136201211123056305649TGGCCCCAGTACAGCGCGGC 2763
4136211231125056505669GGCTGCCGGCGCAGAAACTG 3264
4136221236125556555674GATGAGGCTGCCGGCGCAGA 2565
41362312831302N/AN/AGGCCGGTCCTGCAGGCAGTG 2866
4136241304132359645983ACCGTCAGATCCTCGGGTGC 3367
4136251379139860396058TGCAAGCGGTAGGAGCGCAC 3268
41362614291448N/AN/AGGCGCAACAGAGCCAGGTCG10069
4136271455147461986217GCAGCTGCCGTCCGCATCCT 2870
4136281466148562096228GACAGGAGCGCGCAGCTGCC 2571
4136291492151162356254GCAGGCACACCGGCTGAACG 1972
4136301502152162456264GCGCCGCTTGGCAGGCACAC 2873
4136311559157863026321TCGAACTGGTGGCCCCAGCC 3074
4136321679169869776996CCTGCGCAGAGCATGCCGGG 5075
4136331684170369827001GGAACCCTGCGCAGAGCATG 1776
4136341689170869877006CTCGAGGAACCCTGCGCAGA 3677
4136351695171469937012GCCGCCCTCGAGGAACCCTG 1478
4136361743176271317150GTCCTCACACACCAGCGGGC 1679
4136371748176771367155GCTTGGTCCTCACACACCAG 1880
4136381774179371627181CTTGCAGGGTGAGCCGGCGC 4581
4136391779179871677186GATGCCTTGCAGGGTGAGCC 2982
4136401809182871977216GCGGTCACCACAGCCCGATC 2583
4136411814183372027221TTGTTGCGGTCACCACAGCC 2384
4136421820183972087227CCTGGCTTGTTGCGGTCACC14185
4136431839185872277246GGCCACATCGGTGTAGACGC 1686
4136441844186372327251TAGTAGGCCACATCGGTGTA 3287
4136451849186872377256CCAGGTAGTAGGCCACATCG 2188
4136461854187372427261CCAGGCCAGGTAGTAGGCCA 3889
4136471859187872477266CGGATCCAGGCCAGGTAGTA 3390
4136481891191072797298AGTCCCTGAGCAATCAGGAA 1991
4136491901192072897308GGGAAAGATGAGTCCCTGAG 1492
4136501992201173807399ATCCTGGCGCGGAGCTGGCC 1393
4136512002202173907409TTCCTGCGCCATCCTGGCGC 2394
4136522012203174007419CTTTATTGAGTTCCTGCGCC 1595
4136532022204174107429TTTCAAAGCACTTTATTGAG 1196
4136542027204674157434AGCATTTTCAAAGCACTTTA 2397
TABLE 2
Reduction of FXII RNA by 5-10-5 MOE gapmers
with full PS internucleoside linkages (Huh7,
oligofectamine, 200 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
1122FXIISEQ
CompoundStartStopStartStop(% UTC)ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)RTS2992NO
4136271455147461986217GCAGCTGCCGTCCGCATCCT2770
4136331684170369827001GGAACCCTGCGCAGAGCATG4176
4136351695171469937012GCCGCCCTCGAGGAACCCTG3478
4136431839185872277246GGCCACATCGGTGTAGACGC2386
4136481891191072797298AGTCCCTGAGCAATCAGGAA3391
4136491901192072897308GGGAAAGATGAGTCCCTGAG1892
4136522012203174007419CTTTATTGAGTTCCTGCGCC1495
4621311128114755475566ACTCTTGCGGAGCCGCTGCC2398
4621321145116455645583CGGGTCATCGAAGACAGACT3999
4621331148116755675586ACGCGGGTCATCGAAGACAG24100
4621341151117055705589ACGACGCGGGTCATCGAAGA52101
4621351154117355735592CCAACGACGCGGGTCATCGA57102
4621361157117655765595CCGCCAACGACGCGGGTCAT51103
4621371160117955795598AGCCCGCCAACGACGCGGGT59104
4621381163118255825601ACCAGCCCGCCAACGACGCG45105
4621391166118555855604GCCACCAGCCCGCCAACGAC46106
4621401202122156215640TACAGCGCGGCGATGTAGGG44107
4621411205122456245643CAGTACAGCGCGGCGATGTA61108
4621421208122756275646CCCCAGTACAGCGCGGCGAT30109
4621431214123356335652CTGTGGCCCCAGTACAGCGC28110
4621441217123656365655AAACTGTGGCCCCAGTACAG42111
4621451223124256425661GCGCAGAAACTGTGGCCCCA20112
4621461226124556455664CCGGCGCAGAAACTGTGGCC41113
4621471239125856585677GGCGATGAGGCTGCCGGCGC22114
4621481374139360346053GCGGTAGGAGCGCACGGCCA32115
46214914321451N/AN/AGAAGGCGCAACAGAGCCAGG61116
46215014351454N/AN/ACCTGAAGGCGCAACAGAGCC56117
4621511438145761816200CCTCCTGAAGGCGCAACAGA48118
4621521444146361876206CCGCATCCTCCTGAAGGCGC25119
4621531447146661906209CGTCCGCATCCTCCTGAAGG50120
4621541450146961936212TGCCGTCCGCATCCTCCTGA37121
4621551453147261966215AGCTGCCGTCCGCATCCTCC39122
4621561454147361976216CAGCTGCCGTCCGCATCCTC36123
4621571456147561996218CGCAGCTGCCGTCCGCATCC22124
4621581457147662006219GCGCAGCTGCCGTCCGCATC31125
4621591458147762016220CGCGCAGCTGCCGTCCGCAT28126
4621601461148062046223GAGCGCGCAGCTGCCGTCCG41127
4621611469148862126231GGCGACAGGAGCGCGCAGCT25128
4621621472149162156234TAAGGCGACAGGAGCGCGCA41129
4621631495151462386257TTGGCAGGCACACCGGCTGA32130
4621641498151762416260CGCTTGGCAGGCACACCGGC36131
4621651518153762616280CTCGGAGGGTCGCGCGGCGC28132
4621661562158163056324CCCTCGAACTGGTGGCCCCA42133
4621671596161568946913CGCCTCCTGCAGGAAGCTGG33134
4621681599161868976916CTGCGCCTCCTGCAGGAAGC38135
4621691602162169006919TACCTGCGCCTCCTGCAGGA67136
4621701682170169806999AACCCTGCGCAGAGCATGCC28137
4621711685170469837002AGGAACCCTGCGCAGAGCAT36138
4621721686170569847003GAGGAACCCTGCGCAGAGCA27139
4621731692171169907009GCCCTCGAGGAACCCTGCGC38140
4621741693171269917010CGCCCTCGAGGAACCCTGCG39141
4621751697171669957014GTGCCGCCCTCGAGGAACCC44142
4621761698171769967015GGTGCCGCCCTCGAGGAACC19143
4621771702172170007019CATCGGTGCCGCCCTCGAGG50144
4621781840185972287247AGGCCACATCGGTGTAGACG30145
4621791841186072297248TAGGCCACATCGGTGTAGAC36146
4621801889190872777296TCCCTGAGCAATCAGGAAAC31147
4621811890190972787297GTCCCTGAGCAATCAGGAAA29148
4621821892191172807299GAGTCCCTGAGCAATCAGGA39149
4621831893191272817300TGAGTCCCTGAGCAATCAGG16150
4621841899191872877306GAAAGATGAGTCCCTGAGCA34151
4621851900191972887307GGAAAGATGAGTCCCTGAGC24152
4621861902192172907309AGGGAAAGATGAGTCCCTGA25153
4621871903192272917310GAGGGAAAGATGAGTCCCTG24154
4621881904192372927311GGAGGGAAAGATGAGTCCCT21155
4621891947196673357354TGCCTTCCATGCCCCAGCCA17156
4621901995201473837402GCCATCCTGGCGCGGAGCTG23157
4621911998201773867405TGCGCCATCCTGGCGCGGAG50158
4621922005202473937412GAGTTCCTGCGCCATCCTGG13159
4621932008202773967415ATTGAGTTCCTGCGCCATCC17160
4621942011203073997418TTTATTGAGTTCCTGCGCCA22161
4621952013203274017420ACTTTATTGAGTTCCTGCGC16162
4621962014203374027421CACTTTATTGAGTTCCTGCG8163
4621972015203474037422GCACTTTATTGAGTTCCTGC6164
4621982018203774067425AAAGCACTTTATTGAGTTCC7165
4621992030204974187437CTCAGCATTTTCAAAGCACT22166
TABLE 3
Reduction of FXII RNA by 5-10-5 MOE gapmers with full PS internucleoside linkages (Huh7,
oligofectamine, 200 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
1122FXIISEQ
CompoundStartStopStartStop(% UTC)ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)RTS2992NO
41358221723635683587GGGTACATTTGTGGTACAGC425
41359252053944654484TGCACTGGCATCTGGCCACA5735
41361080882750375056GTCCCCAGTTCCGCGCTTGC4543
41361181883750475066TGGCCGCCCAGTCCCCAGTT7754
413612839858N/AN/ATCCGGGTTCCGGCAGAAGGC6855
4136522012203174007419CTTTATTGAGTTCCTGCGCC3095
46205655745574ACCCCAGGAGCAGCAGAGCC58167
46205758775877GGAACCCCAGGAGCAGCAGA67168
46205861806180GCAGGAACCCCAGGAGCAGC62169
46205964836483CCAGCAGGAACCCCAGGAGC76170
46206095114N/AN/AGGTGGAATCGAAAGTGTTGA65171
46206198117N/AN/ACAAGGTGGAATCGAAAGTGT63172
462062137156504523TGCTCTTCAGCTTTGTACTT23173
462063140159507526GTGTGCTCTTCAGCTTTGTA6174
462064143162510529ACTGTGTGCTCTTCAGCTTT10175
462065146165N/AN/AACGACTGTGTGCTCTTCAGC9176
462067155174N/AN/AACAGTGAGAACGACTGTGTG30177
46206816718635183537GGCTCCCCGGTGACAGTGAG13178
46206917018935213540CAGGGCTCCCCGGTGACAGT14179
46207017319235243543TGGCAGGGCTCCCCGGTGAC16180
46207117619535273546AAGTGGCAGGGCTCCCCGGT70181
46207221523435663585GTACATTTGTGGTACAGCTG16182
46207321623535673586GGTACATTTGTGGTACAGCT24183
46207421923835703589GTGGGTACATTTGTGGTACA38184
46207522324235743593CCTTGTGGGTACATTTGTGG48185
46207623024935813600GGCCGGCCCTTGTGGGTACA65186
46207731533438223841TTTCACTTTCTTGGGCTCCA46187
462078318337N/AN/AGTCTTTCACTTTCTTGGGCT59188
462079321340N/AN/AGTGGTCTTTCACTTTCTTGG69189
46208044846743934412GCTGAGGCTCAAAGCACTTC42190
46208145547444004419CGGAGAAGCTGAGGCTCAAA71191
46208245847744034422AACCGGAGAAGCTGAGGCTC60192
46208346548444104429GTGGAAAAACCGGAGAAGCT46193
46208448650544314450TCTATACCATATCTCATTCT57194
46208550752644524471GGCCACAGCTGCTTGCTCAG44195
46208651853744634482CACTGGCATCTGGCCACAGC51196
46208751953844644483GCACTGGCATCTGGCCACAG62197
46208852154044664485TTGCACTGGCATCTGGCCAC37198
46208952254144674486CTTGCACTGGCATCTGGCCA55199
46209052354244684487CCTTGCACTGGCATCTGGCC81200
46209153455344794498GGCATCAGGACCCTTGCACT35201
46209254156044864505GGCAGTGGGCATCAGGACCC59202
46209354456344894508GCTGGCAGTGGGCATCAGGA85203
462094575594N/AN/AGGGTTGGTGCGGCAGGCCTG68204
46209557859746624681CACGGGTTGGTGCGGCAGGC65205
46209658160046654684AGGCACGGGTTGGTGCGGCA65206
46209758460346684687TGGAGGCACGGGTTGGTGCG105207
46209859060946744693CCCCCATGGAGGCACGGGTT32208
46209959361246774696CGACCCCCATGGAGGCACGG51209
46210059661546804699CAGCGACCCCCATGGAGGCA59210
46210159961846834702AGGCAGCGACCCCCATGGAG51211
46210260262146864705TCTAGGCAGCGACCCCCATG50212
46210360562446894708ACCTCTAGGCAGCGACCCCC59213
46210461163046954714CCCTCCACCTCTAGGCAGCG60214
46210561463346984717TGGCCCTCCACCTCTAGGCA47215
46210662063947044723AGGCGGTGGCCCTCCACCTC73216
46210762364247074726CACAGGCGGTGGCCCTCCAC27217
46210862964847134732CAGTGGCACAGGCGGTGGCC45218
46210963265147164735GGGCAGTGGCACAGGCGGTG54219
46211070872749374956GCGGTAGCTGAGCCCGCGGC81220
46211172674549554974CGTGGTCCTGGCCAGGCCGC61221
46211280382250325051CAGTTCCGCGCTTGCTCGGC51222
46211380682550355054CCCCAGTTCCGCGCTTGCTC44223
46211480782650365055TCCCCAGTTCCGCGCTTGCT69224
46211580982850385057AGTCCCCAGTTCCGCGCTTG55225
46211681082950395058CAGTCCCCAGTTCCGCGCTT56226
46211781183050405059CCAGTCCCCAGTTCCGCGCT40227
46211881483350435062CGCCCAGTCCCCAGTTCCGC60228
46211981783650465065GGCCGCCCAGTCCCCAGTTC57229
46212082083950495068CGTGGCCGCCCAGTCCCCAG43230
462121838857N/AN/ACCGGGTTCCGGCAGAAGGCG59231
462122841860N/AN/ATGTCCGGGTTCCGGCAGAAG95232
462123842861N/AN/ATTGTCCGGGTTCCGGCAGAA96233
46212486688551805199ACGAAGCACCACGGGCGGAT85234
4621251002102153165335CTTCGGCGGTGCCGGCTGCG57235
4621261122114155415560GCGGAGCCGCTGCCCGCAGC80236
4621271125114455445563CTTGCGGAGCCGCTGCCCGC79237
TABLE 4
Reduction of FXII RNA by 5-10-5 MOE gapmers with full PS internucleoside linkages (Huh7,
electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
1122FXIISEQ
CompoundStartStopStartStop(% UTC)ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)RTS40528NO
 413612839858N/AN/ATCCGGGTTCCGGCAGAAGGC3155
 46207321623535673586GGTACATTTGTGGTACAGCT10183
 4621922005202473937412GAGTTCCTGCGCCATCCTGG22159
112416332513251ATGGCATCCGTCCGTTGGTC70238
112419178977897TGACTCCAAGCTCACCAGCA79239
1124219135154502521CTCTTCAGCTTTGTACTTAT60240
112424517119035223541GCAGGGCTCCCCGGTGACAG42241
112426822524435763595GCCCTTGTGGGTACATTTGT79242
112429629030937973816TATCCCCATCGCTGGTCCTG31243
1124324331350N/AN/AGTTTGCTGCAGTGGTCTTTC25244
112435240442342124231AGGTGTTGTGGACAGAGACA60245
112438044646543914410TGAGGCTCAAAGCACTTCTC43246
112440748950844344453AGTTCTATACCATATCTCAT32247
112443553255144774496CATCAGGACCCTTGCACTGG54248
1124462566585N/AN/ACGGCAGGCCTGGCTGGCCAG33249
112448960662546904709CACCTCTAGGCAGCGACCCC21250
112451765367247374756AAGGCTCCGGTGTAGCCCAC48251
112454570972849384957CGCGGTAGCTGAGCCCGCGG65252
112457276278149915010CTCCGAGGCCCACGGCTGAC39253
112462090292152165235TCGCAGTACTCCCAGCTCAG19254
1124648993101253075326TGCCGGCTGCGCGGGCATGA37255
11246761071109054905509CTGCTCCCGCTTCGCCGGCA79256
11247041116113555355554CCGCTGCCCGCAGCTCAGTG50257
11247301152117155715590AACGACGCGGGTCATCGAAG27258
11247571224124356435662GGCGCAGAAACTGTGGCCCC32259
11247841311133059715990GAGCACCACCGTCAGATCCT30260
11248121380139960406059GTGCAAGCGGTAGGAGCGCA48261
11248391459147862026221GCGCGCAGCTGCCGTCCGCA27262
11248631548156762916310GCCCCAGCCGGCCACCTGGC149263
112489015781597N/AN/AGGCATATTCCTCCGCCCCCT37264
11249171620163969186937CTCCAGGGAGAGGAACGGTA116265
11249431746176571347153TTGGTCCTCACACACCAGCG10266
11249701793181271817200GATCCCCAGCTGATGATGCC94267
11249961823184272117230ACGCCTGGCTTGTTGCGGTC24268
11250211870188972587277CGGTGTGCTCCCGGATCCAG50269
11250471915193473037322GGAATCACCAAGGAGGGAAA14270
11250741950196973387357TCTTGCCTTCCATGCCCCAG18271
1125122N/AN/A94113CACTCACCGAAAGTGTTGAC40272
1125150N/AN/A178197CCACAGGTCATGAGCAGAGG63273
1125178N/AN/A274293TGCCCTTGTATCCACCCAGT71274
1125206N/AN/A368387CCCAGAAATGCAGAGATTTC103275
1125234N/AN/A457476AATCTACAAGGGAGAGAAGA51276
1125262N/AN/A603622GGCACTAGACTAGACTGCCC33277
1125290N/AN/A690709CTTAGACACAGCCCATACCC25278
1125318N/AN/A859878ATTGAAGGCCCTGGCCTCTG37279
1125346N/AN/A957976TCAAATCCCTCGCCCAGAGT56280
1125374N/AN/A10641083CAGGTGATGGGCTGAATACC123281
1125402N/AN/A11971216AATTTAGTGTCTGGAAGAAT44282
1125430N/AN/A15751594CCCCACCAAGTCAGGCCCAC66283
1125458N/AN/A17471766TGGACGGACAGAGAGGAGGG127284
1125486N/AN/A21232142AGGACCAAACCAGAACTAGG119285
1125514N/AN/A22532272TGTCTTCTTCAGAGGAATTG47286
1125542N/AN/A23412360GGCTCACAGGAACCTAATAC36287
1125570N/AN/A24792498GATTCAGGTGTGTGCTATAG13288
1125598N/AN/A26092628GTTTTTCACACTTTGTGCTT31289
1125626N/AN/A27342753GGGCATGCACAGAGCAGTGA47290
1125654N/AN/A28322851CTCATTCTTCTCTGGTTCTA32291
1125682N/AN/A29392958TAGGCACTTAATAATACTTG51292
1125710N/AN/A30423061GGAGTCAGATAGCTGGAGTA163293
1125738N/AN/A34363455CTCAGGGTCTGGTCAGGAAA62294
1125766N/AN/A36313650CAGGCCCCTGCTCCAACTCC107295
1125794N/AN/A37433762GAGACAAGGCTTCCCTGCTC38296
1125822N/AN/A38893908GATACCAGGAGAGTAATGAG103297
1125850N/AN/A40154034AAGCTTGGTTTACCCACCTG94298
1125878N/AN/A41224141GAGAGATGGACATGGTGGAA79299
1125906N/AN/A43104329CCAGCAACCTATTCTGTAGG47300
1125934N/AN/A45354554CTCCCTGGCCCGTTCCCAAC30301
1125962N/AN/A46324651AACGCAGTGAGCCACCCCTG61302
1125990N/AN/A48594878CTGGGCTCTCCTGCCTCCCT80303
1126018N/AN/A53835402TTCCCCCCCCCACTTCCTAA187304
1126046N/AN/A57515770GAGACGGAGGAGCCGCGGCC120305
1126074N/AN/A61586177AACCCGGGCGGAGAGGAGCG170306
1126102N/AN/A63736392GGCTTCTTCCGCCTAACCCA111307
1126130N/AN/A64816500TGAATCCCAGGCCCTGGGAT73308
1126158N/AN/A66216640GAGTCGCAGAACCTGGCTCC84309
1126186N/AN/A67126731ATTTCATAGGCAAGGAGGCT53310
1126214N/AN/A68396858CTTCACACCCCATCTGACAA82311
1126242N/AN/A71067125GAATCACCCTGGGTCGGAAA43312
TABLE 5
Reduction of FXII RNA by 5-10-5 MOE gapmers with full PS internucleoside linkages (Huh7,
electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
1122FXIISEQ
CompoundStartStopStartStop(% UTC)ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)RTS40528NO
 4136431839185872277246GGCCACATCGGTGTAGACGC1486
 46207321623535673586GGTACATTTGTGGTACAGCT36183
 626671840859N/AN/AGTCCGGGTTCCGGCAGAAGG19313
112416433523352CATGGCATCCGTCCGTTGGT24314
112419279987998TTGACTCCAAGCTCACCAGC95315
1124220136155503522GCTCTTCAGCTTTGTACTTA93316
112424617219135233542GGCAGGGCTCCCCGGTGACA36317
112426922624535773596GGCCCTTGTGGGTACATTTG34318
112429729231137993818AGTATCCCCATCGCTGGTCC24319
1124325332351N/AN/ATGTTTGCTGCAGTGGTCTTT92320
112435340542442134232GAGGTGTTGTGGACAGAGAC24321
112438144746643924411CTGAGGCTCAAAGCACTTCT27322
112440849351244384457GCTCAGTTCTATACCATATC18323
112443653355244784497GCATCAGGACCCTTGCACTG78324
1124463568587N/AN/ATGCGGCAGGCCTGGCTGGCC65325
112449060762646914710CCACCTCTAGGCAGCGACCC17326
112451865467347384757GAAGGCTCCGGTGTAGCCCA75327
112454671072949394958CCGCGGTAGCTGAGCCCGCG170328
112457376378249925011CCTCCGAGGCCCACGGCTGA27329
112462190392252175236GTCGCAGTACTCCCAGCTCA23330
1124649994101353085327GTGCCGGCTGCGCGGGCATG42331
11246771072109154915510GCTGCTCCCGCTTCGCCGGC23332
11247051117113655365555GCCGCTGCCCGCAGCTCAGT40333
11247311153117255725591CAACGACGCGGGTCATCGAA64334
11247581225124456445663CGGCGCAGAAACTGTGGCCC35335
11247851312133159725991CGAGCACCACCGTCAGATCC30336
11248131381140060416060CGTGCAAGCGGTAGGAGCGC18337
11248401460147962036222AGCGCGCAGCTGCCGTCCGC59338
11248641549156862926311GGCCCCAGCCGGCCACCTGG54339
112489115791598N/AN/ATGGCATATTCCTCCGCCCCC34340
11249181621164069196938GCTCCAGGGAGAGGAACGGT84341
11249441747176671357154CTTGGTCCTCACACACCAGC7342
11249711794181371827201CGATCCCCAGCTGATGATGC66343
11250221871189072597278ACGGTGTGCTCCCGGATCCA26344
11250481916193573047323CGGAATCACCAAGGAGGGAA35345
11250751951197073397358ATCTTGCCTTCCATGCCCCA23346
11251012006202573947413TGAGTTCCTGCGCCATCCTG7347
1125123N/AN/A97116CAGCACTCACCGAAAGTGTT67348
1125151N/AN/A181200GACCCACAGGTCATGAGCAG50349
1125179N/AN/A277296CTGTGCCCTTGTATCCACCC67350
1125207N/AN/A371390CAGCCCAGAAATGCAGAGAT45351
1125235N/AN/A460479TGGAATCTACAAGGGAGAGA125352
1125263N/AN/A606625GTAGGCACTAGACTAGACTG129353
1125291N/AN/A693712GCACTTAGACACAGCCCATA69354
1125319N/AN/A862881CCCATTGAAGGCCCTGGCCT38355
1125347N/AN/A960979AACTCAAATCCCTCGCCCAG77356
1125375N/AN/A10671086CACCAGGTGATGGGCTGAAT86357
1125403N/AN/A12001219GGTAATTTAGTGTCTGGAAG130358
1125431N/AN/A15781597CAACCCCACCAAGTCAGGCC74359
1125459N/AN/A17501769GGATGGACGGACAGAGAGGA60360
1125487N/AN/A21262145CCAAGGACCAAACCAGAACT84361
1125515N/AN/A22562275CTGTGTCTTCTTCAGAGGAA50362
1125543N/AN/A23702389TGTTGGTTGATGAAAATGTT55363
1125571N/AN/A24822501CTTGATTCAGGTGTGTGCTA73364
1125599N/AN/A26282647TCAGTCTACTTAGTGCAACG98365
1125627N/AN/A27392758TTTGTGGGCATGCACAGAGC31366
1125655N/AN/A28352854ATCCTCATTCTTCTCTGGTT26367
1125683N/AN/A29422961AAGTAGGCACTTAATAATAC73368
1125711N/AN/A30453064TCAGGAGTCAGATAGCTGGA100369
1125739N/AN/A34393458TCCCTCAGGGTCTGGTCAGG25370
1125767N/AN/A36373656GTCTCCCAGGCCCCTGCTCC77371
1125795N/AN/A37493768TAGAAAGAGACAAGGCTTCC102372
1125823N/AN/A38923911GGTGATACCAGGAGAGTAAT93373
1125851N/AN/A40184037TCCAAGCTTGGTTTACCCAC38374
1125879N/AN/A41254144TCTGAGAGATGGACATGGTG69375
1125907N/AN/A43134332TATCCAGCAACCTATTCTGT152376
1125935N/AN/A45384557CTCCTCCCTGGCCCGTTCCC64377
1125963N/AN/A46354654GGGAACGCAGTGAGCCACCC97378
1125991N/AN/A48624881AGGCTGGGCTCTCCTGCCTC105379
1126019N/AN/A53865405TCCTTCCCCCCCCCACTTCC37380
1126047N/AN/A57545773TGGGAGACGGAGGAGCCGCG87381
1126075N/AN/A61616180GCTAACCCGGGCGGAGAGGA36382
1126103N/AN/A63766395GCGGGCTTCTTCCGCCTAAC66383
1126131N/AN/A64846503CAGTGAATCCCAGGCCCTGG34384
1126159N/AN/A66246643CCAGAGTCGCAGAACCTGGC34385
1126187N/AN/A67156734TCAATTTCATAGGCAAGGAG28386
1126215N/AN/A68426861CTTCTTCACACCCCATCTGA100387
1126243N/AN/A71097128CCGGAATCACCCTGGGTCGG28388
TABLE 6
Reduction of FXII RNA by 5-10-5 MOE gapmers with full PS internucleoside linkages (Huh7,
electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
1122FXIISEQ
CompoundStartStopStartStop(% UTC)ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)RTS40528NO
 4136371748176771367155GCTTGGTCCTCACACACCAG1280
 46207321623535673586GGTACATTTGTGGTACAGCT20183
112419380998099GTTGACTCCAAGCTCACCAG34389
1124221138157505524GTGCTCTTCAGCTTTGTACT37390
112424717419335253544GTGGCAGGGCTCCCCGGTGA54391
112427022824735793598CCGGCCCTTGTGGGTACATT51392
112429829331238003819CAGTATCCCCATCGCTGGTC36393
1124326333352N/AN/AGTGTTTGCTGCAGTGGTCTT56394
112435440642542144233TGAGGTGTTGTGGACAGAGA56395
112438244946843944413AGCTGAGGCTCAAAGCACTT38396
112440949451344394458TGCTCAGTTCTATACCATAT31397
112443753555444804499GGGCATCAGGACCCTTGCAC66398
1124464569588N/AN/AGTGCGGCAGGCCTGGCTGGC70399
112449160962846934712CTCCACCTCTAGGCAGCGAC28400
112451965567447394758AGAAGGCTCCGGTGTAGCCC102401
112454771173049404959GCCGCGGTAGCTGAGCCCGC58402
112457476578449945013GGCCTCCGAGGCCCACGGCT44403
1124597843862N/AN/AGTTGTCCGGGTTCCGGCAGA45404
112462290492352185237GGTCGCAGTACTCCCAGCTC42405
1124650996101553105329CGGTGCCGGCTGCGCGGGCA90406
11246781073109254925511GGCTGCTCCCGCTTCGCCGG92407
11247061118113755375556AGCCGCTGCCCGCAGCTCAG39408
11247321155117455745593GCCAACGACGCGGGTCATCG38409
11247591227124656465665GCCGGCGCAGAAACTGTGGC55410
11247861313133259735992CCGAGCACCACCGTCAGATC40411
11248141399141860596078TGACGGGCGAGAAGGCCTCG59412
11248411462148162056224GGAGCGCGCAGCTGCCGTCC44413
11248651550156962936312TGGCCCCAGCCGGCCACCTG53414
11248921581160068796898GCTGGCATATTCCTCCGCCC78415
11249191622164169206939CGCTCCAGGGAGAGGAACGG80416
11249721795181471837202CCGATCCCCAGCTGATGATG41417
11249971842186172307249GTAGGCCACATCGGTGTAGA39418
11250231873189272617280AAACGGTGTGCTCCCGGATC26419
11250491917193673057324GCGGAATCACCAAGGAGGGA20420
11250761952197173407359AATCTTGCCTTCCATGCCCC22421
11251022007202673957414TTGAGTTCCTGCGCCATCCT15422
1125124N/AN/A100119CCACAGCACTCACCGAAAGT102423
1125152N/AN/A184203CTGGACCCACAGGTCATGAG87424
1125180N/AN/A280299AGGCTGTGCCCTTGTATCCA109425
1125208N/AN/A374393TCACAGCCCAGAAATGCAGA82426
1125236N/AN/A463482AGGTGGAATCTACAAGGGAG100427
1125264N/AN/A609628CAGGTAGGCACTAGACTAGA81428
1125292N/AN/A696715TGGGCACTTAGACACAGCCC52429
1125320N/AN/A865884TTGCCCATTGAAGGCCCTGG39430
1125348N/AN/A963982GAGAACTCAAATCCCTCGCC50431
1125376N/AN/A10701089ATGCACCAGGTGATGGGCTG62432
1125404N/AN/A12031222GTAGGTAATTTAGTGTCTGG59433
1125432N/AN/A15811600ACTCAACCCCACCAAGTCAG52434
1125460N/AN/A17531772ATGGGATGGACGGACAGAGA58435
1125488N/AN/A21292148TTGCCAAGGACCAAACCAGA72436
1125516N/AN/A22592278TGCCTGTGTCTTCTTCAGAG61437
1125544N/AN/A23732392TGCTGTTGGTTGATGAAAAT62438
1125572N/AN/A24852504ACACTTGATTCAGGTGTGTG74439
1125600N/AN/A26342653TCCTTCTCAGTCTACTTAGT49440
1125628N/AN/A27422761CCATTTGTGGGCATGCACAG75441
1125656N/AN/A28382857TTGATCCTCATTCTTCTCTG77442
1125684N/AN/A29502969TTGCCACAAAGTAGGCACTT51443
1125712N/AN/A30483067GGTTCAGGAGTCAGATAGCT66444
1125740N/AN/A34423461CTGTCCCTCAGGGTCTGGTC61445
1125768N/AN/A36403659CATGTCTCCCAGGCCCCTGC73446
1125796N/AN/A37523771CTGTAGAAAGAGACAAGGCT59447
1125824N/AN/A38953914TCTGGTGATACCAGGAGAGT48448
1125852N/AN/A40214040GTTTCCAAGCTTGGTTTACC54449
1125880N/AN/A41284147TGGTCTGAGAGATGGACATG59450
1125908N/AN/A43164335GAGTATCCAGCAACCTATTC67451
1125936N/AN/A45414560ACGCTCCTCCCTGGCCCGTT60452
1125964N/AN/A46384657GGAGGGAACGCAGTGAGCCA127453
1125992N/AN/A48664885GCCAAGGCTGGGCTCTCCTG57454
1126020N/AN/A53895408TCCTCCTTCCCCCCCCCACT82455
1126048N/AN/A57575776CGCTGGGAGACGGAGGAGCC116456
1126076N/AN/A61646183AGAGCTAACCCGGGCGGAGA120457
1126104N/AN/A63796398GTCGCGGGCTTCTTCCGCCT54458
1126132N/AN/A64876506CAGCAGTGAATCCCAGGCCC96459
1126160N/AN/A66276646CATCCAGAGTCGCAGAACCT105460
1126188N/AN/A67186737AATTCAATTTCATAGGCAAG73461
1126216N/AN/A68456864CGCCTTCTTCACACCCCATC68462
1126244N/AN/A71127131CCTCCGGAATCACCCTGGGT31463
TABLE 7
Reduction of FXII RNA by 5-10-5 MOE gapmers with full PS internucleoside linkages (Huh7,
electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
1122FXIISEQ
CompoundStartStopStartStop(% UTC)ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)RTS40528NO
 46207321623535673586GGTACATTTGTGGTACAGCT15183
 5648421463148262066225AGGAGCGCGCAGCTGCCGTC44464
11241948210182101GTGTTGACTCCAAGCTCACC63465
1124222139158506525TGTGCTCTTCAGCTTTGTAC25466
112424817519435263545AGTGGCAGGGCTCCCCGGTG48467
112427122924835803599GCCGGCCCTTGTGGGTACAT49468
112429929431338013820ACAGTATCCCCATCGCTGGT46469
112432733435341424161TGTGTTTGCTGCAGTGGTCT52470
112435540742642154234GTGAGGTGTTGTGGACAGAG110471
112438345046943954414AAGCTGAGGCTCAAAGCACT55472
112441049551444404459TTGCTCAGTTCTATACCATA36473
112443853655544814500TGGGCATCAGGACCCTTGCA51474
1124465570589N/AN/AGGTGCGGCAGGCCTGGCTGG140475
112449261062946944713CCTCCACCTCTAGGCAGCGA38476
112452065667547404759CAGAAGGCTCCGGTGTAGCC63477
112454871273149414960GGCCGCGGTAGCTGAGCCCG66478
112457576678549955014TGGCCTCCGAGGCCCACGGC65479
1124598844863N/AN/ACGTTGTCCGGGTTCCGGCAG33480
112462390592452195238AGGTCGCAGTACTCCCAGCT47481
1124651997101653115330GCGGTGCCGGCTGCGCGGGC57482
11246791075109454945513GCGGCTGCTCCCGCTTCGCC45483
11247071120113955395558GGAGCCGCTGCCCGCAGCTC47484
11247331156117555755594CGCCAACGACGCGGGTCATC42485
11247601228124756475666TGCCGGCGCAGAAACTGTGG64486
11247871314133359745993GCCGAGCACCACCGTCAGAT36487
11248151400141960606079CTGACGGGCGAGAAGGCCTC45488
11248661551157062946313GTGGCCCCAGCCGGCCACCT118489
11248931582160168806899AGCTGGCATATTCCTCCGCC81490
11249201623164269216940GCGCTCCAGGGAGAGGAACG79491
11249451749176871377156AGCTTGGTCCTCACACACCA121492
11249731796181571847203CCCGATCCCCAGCTGATGAT39493
11249981843186272317250AGTAGGCCACATCGGTGTAG31494
11250241874189372627281GAAACGGTGTGCTCCCGGAT34495
11250501918193773067325TGCGGAATCACCAAGGAGGG23496
11250771954197373427361ACAATCTTGCCTTCCATGCC23497
11251032009202873977416TATTGAGTTCCTGCGCCATC25498
1125125N/AN/A103122TTCCCACAGCACTCACCGAA84499
1125153N/AN/A187206CACCTGGACCCACAGGTCAT110500
1125181N/AN/A283302TGCAGGCTGTGCCCTTGTAT78501
1125209N/AN/A377396CTCTCACAGCCCAGAAATGC68502
1125237N/AN/A466485CCAAGGTGGAATCTACAAGG78503
1125265N/AN/A612631CACCAGGTAGGCACTAGACT64504
1125293N/AN/A716735CCTGCTCCGAGCCAGGCTCG74505
1125321N/AN/A868887TCCTTGCCCATTGAAGGCCC65506
1125349N/AN/A966985TTGGAGAACTCAAATCCCTC66507
1125377N/AN/A10731092TCCATGCACCAGGTGATGGG58508
1125405N/AN/A12061225CATGTAGGTAATTTAGTGTC90509
1125433N/AN/A15841603GAGACTCAACCCCACCAAGT88510
1125461N/AN/A17561775CAGATGGGATGGACGGACAG65511
1125489N/AN/A21322151CACTTGCCAAGGACCAAACC86512
1125517N/AN/A22622281AATTGCCTGTGTCTTCTTCA57513
1125545N/AN/A23762395ATATGCTGTTGGTTGATGAA55514
1125573N/AN/A24882507TAGACACTTGATTCAGGTGT57515
1125601N/AN/A26372656GTGTCCTTCTCAGTCTACTT68516
1125629N/AN/A27452764TGGCCATTTGTGGGCATGCA54517
1125657N/AN/A28412860CAGTTGATCCTCATTCTTCT59518
1125685N/AN/A29532972CACTTGCCACAAAGTAGGCA51519
1125713N/AN/A30513070TTGGGTTCAGGAGTCAGATA116520
1125741N/AN/A34453464GCACTGTCCCTCAGGGTCTG68521
1125769N/AN/A36433662GTACATGTCTCCCAGGCCCC57522
1125797N/AN/A37553774CACCTGTAGAAAGAGACAAG148523
1125825N/AN/A38983917GGGTCTGGTGATACCAGGAG56524
1125853N/AN/A40244043CAAGTTTCCAAGCTTGGTTT53525
1125881N/AN/A41314150CAGTGGTCTGAGAGATGGAC56526
1125909N/AN/A43194338TCCGAGTATCCAGCAACCTA88527
1125937N/AN/A45574576CCAGCCTGTCTTCCTGACGC63528
1125965N/AN/A46574676GTTGGTGCGGCAGGCTTGGG60529
1125993N/AN/A48694888GCAGCCAAGGCTGGGCTCTC75530
1126021N/AN/A53925411GGCTCCTCCTTCCCCCCCCC54531
1126049N/AN/A57605779CTGCGCTGGGAGACGGAGGA181532
1126077N/AN/A61676186AACAGAGCTAACCCGGGCGG67533
1126105N/AN/A63826401AAAGTCGCGGGCTTCTTCCG59534
1126133N/AN/A64906509TCCCAGCAGTGAATCCCAGG88535
1126161N/AN/A66306649ACCCATCCAGAGTCGCAGAA72536
1126189N/AN/A67216740ATTAATTCAATTTCATAGGC76537
1126217N/AN/A68626881CCCCTGCGAACACAGAGCGC105538
TABLE 8
Reduction of FXII RNA by 5-10-5 MOE gapmers with full PS internucleoside linkages (Huh7,
electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
1122FXIISEQ
CompoundStartStopStartStop(% UTC)ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)RTS40528NO
 4136441844186372327251TAGTAGGCCACATCGGTGTA3287
 46207321623535673586GGTACATTTGTGGTACAGCT48183
56482286288151765195AGCACCACGGGCGGATGTCG69539
112416736553655CCTCATGGCATCCGTCCGTT42540
11241958310283102AGTGTTGACTCCAAGCTCAC45541
1124223141160508527TGTGTGCTCTTCAGCTTTGT32542
112424917719635283547GAAGTGGCAGGGCTCCCCGG54543
112427223125035823601TGGCCGGCCCTTGTGGGTAC141544
112430029631538033822AAACAGTATCCCCATCGCTG66545
112432833535441434162CTGTGTTTGCTGCAGTGGTC38546
112435640842742164235AGTGAGGTGTTGTGGACAGA73547
112438445147043964415GAAGCTGAGGCTCAAAGCAC32548
112441149651544414460CTTGCTCAGTTCTATACCAT52549
112443953755644824501GTGGGCATCAGGACCCTTGC45550
1124466571590N/AN/ATGGTGCGGCAGGCCTGGCTG146551
112449361263146964715GCCCTCCACCTCTAGGCAGC70552
112452165767647414760GCAGAAGGCTCCGGTGTAGC97553
112454971473349434962CAGGCCGCGGTAGCTGAGCC99554
112457676778649965015GTGGCCTCCGAGGCCCACGG78555
112462490792652215240CCAGGTCGCAGTACTCCCAG51556
1124652998101753125331GGCGGTGCCGGCTGCGCGGG70557
11246801076109554955514GGCGGCTGCTCCCGCTTCGC67558
11247081121114055405559CGGAGCCGCTGCCCGCAGCT136559
11247341158117755775596CCCGCCAACGACGCGGGTCA51560
11247611229124856485667CTGCCGGCGCAGAAACTGTG54561
11247881315133459755994GGCCGAGCACCACCGTCAGA100562
11248161401142060616080GCTGACGGGCGAGAAGGCCT70563
11248421464148362076226CAGGAGCGCGCAGCTGCCGT40564
11248671552157162956314GGTGGCCCCAGCCGGCCACC66565
11248941583160268816900AAGCTGGCATATTCCTCCGC80566
11249211657167669556974GGATGGAGGATCCGTGCACG30567
11249461750176971387157CAGCTTGGTCCTCACACACC18568
11249741797181671857204GCCCGATCCCCAGCTGATGA43569
11250251876189572647283AGGAAACGGTGTGCTCCCGG42570
11250511919193873077326CTGCGGAATCACCAAGGAGG26571
11250781955197473437362CACAATCTTGCCTTCCATGC37572
11251042010202973987417TTATTGAGTTCCTGCGCCAT22573
1125126N/AN/A106125TGGTTCCCACAGCACTCACC73574
1125154N/AN/A190209AGTCACCTGGACCCACAGGT78575
1125182N/AN/A286305AAATGCAGGCTGTGCCCTTG69576
1125210N/AN/A380399TTCCTCTCACAGCCCAGAAA60577
1125238N/AN/A469488TTCCCAAGGTGGAATCTACA84578
1125266N/AN/A615634TAGCACCAGGTAGGCACTAG66579
1125294N/AN/A721740AAGCACCTGCTCCGAGCCAG56580
1125322N/AN/A871890CCTTCCTTGCCCATTGAAGG60581
1125350N/AN/A969988AGCTTGGAGAACTCAAATCC62582
1125378N/AN/A10761095ATTTCCATGCACCAGGTGAT62583
1125406N/AN/A12091228TGGCATGTAGGTAATTTAGT63584
1125434N/AN/A15871606TTAGAGACTCAACCCCACCA143585
1125462N/AN/A17591778ATGCAGATGGGATGGACGGA167586
1125490N/AN/A21352154GTGCACTTGCCAAGGACCAA73587
1125518N/AN/A22652284GAGAATTGCCTGTGTCTTCT55588
1125546N/AN/A23792398ATTATATGCTGTTGGTTGAT123589
1125574N/AN/A25132532GCTACCTTAGGGAGAAAGCG121590
1125602N/AN/A26402659TGAGTGTCCTTCTCAGTCTA69591
1125630N/AN/A27482767TCATGGCCATTTGTGGGCAT89592
1125658N/AN/A28452864AGTACAGTTGATCCTCATTC162593
1125686N/AN/A29562975GAGCACTTGCCACAAAGTAG91594
1125714N/AN/A30543073AACTTGGGTTCAGGAGTCAG105595
1125742N/AN/A34483467CAGGCACTGTCCCTCAGGGT141596
1125770N/AN/A36493668GGCAGGGTACATGTCTCCCA68597
1125798N/AN/A37583777GCACACCTGTAGAAAGAGAC82598
1125826N/AN/A39163935CAGAATCCCAGGTGTGTGGG54599
1125854N/AN/A40274046CTCCAAGTTTCCAAGCTTGG116600
1125882N/AN/A41344153CTGCAGTGGTCTGAGAGATG102601
1125910N/AN/A43254344CAAGTCTCCGAGTATCCAGC96602
1125938N/AN/A45604579CTGCCAGCCTGTCTTCCTGA80603
1125966N/AN/A46604679CGGGTTGGTGCGGCAGGCTT95604
1125994N/AN/A48754894CCCTGGGCAGCCAAGGCTGG67605
1126022N/AN/A53955414CTCGGCTCCTCCTTCCCCCC61606
1126050N/AN/A57635782AAGCTGCGCTGGGAGACGGA123607
1126078N/AN/A61706189CGCAACAGAGCTAACCCGGG76608
1126106N/AN/A63856404ACCAAAGTCGCGGGCTTCTT150609
1126134N/AN/A64936512GGATCCCAGCAGTGAATCCC70610
1126162N/AN/A66336652ACCACCCATCCAGAGTCGCA60611
1126190N/AN/A67246743GCCATTAATTCAATTTCATA72612
1126218N/AN/A68656884CCGCCCCTGCGAACACAGAG66613
TABLE 9
Reduction of FXII RNA by 5-10-5 MOE gapmers
with full PS internucleoside linkages (Huh7,
oligofectamine, 200 nM modified
oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
Com-3344SEQ
poundStartStopStartStopSequenceFXIIID
NumberSiteSiteSiteSite(5′ to 3′)(% UTC)NO
4622001084510864N/AN/ACTTCTCAGCA63614
TTTTCAAAGC
4622011084810867N/AN/ATTCCTTCTCA63615
GCATTTTCAA
TABLE 10
Reduction of FXII RNA by 5-10-5 MOE gapmers
with full PS internucleoside linkages
(Huh7, electroporation, 5000 nM
modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
Com-3344SEQ
poundStartStopStartStopSequenceFXIIID
NumberSiteSiteSiteSite(5′ to 3′)(% UTC)NO
11262461084910868N/AN/ATTTCCTTCTC130616
AGCATTTTCA
TABLE 11
Reduction of FXII RNA by 5-10-5 MOE gapmers
with full PS internucleoside linkages
electroporation, 5000 nM modified
oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
Com-3344SEQ
poundStartStopStartStopSequenceFXIIID
NumberSiteSiteSiteSite(5′ to 3′)(% UTC)NO
1124165345834773453TCATGGCATC60617
CGTCCGTTGG
11262451084610865N/AN/ACCTTCTCAGC77618
ATTTTCAAAG
1124166345934783554CTCATGGCAT52619
CCGTCCGTTG

Modified oligonucleotides complementary to a FXII nucleic acid were synthesized and tested for their effect on FXII RNA levels in vitro. The modified oligonucleotides were tested in a series of experiments using similar culture conditions. The results for each separate experiment are presented in separate tables below.

The modified oligonucleotides in the tables below 5-10-5 MOE gapmers (i.e., they have a central region of ten 2′-deoxynucleosides flanked on each side by wings, each comprising five 2′-MOE nucleosides). The motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): soooossssssssssooss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

“Start site” indicates the 5′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. “Stop site” indicates the 3′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are 100% complementary to one or more of human FXII target sequences including the human FXII mRNA sequence designated herein as SEQ ID NO: 1 (ENSEMBL ID ENST00000253496.3 from ENSEMBL version 99: January 2020), the human FXII genomic sequence, designated herein as SEQ ID NO: 2 (ENSEMBL ID ENSG00000131187.9 from ENSEMBL version 99: January 2020), the human FXII genomic sequence, designated herein as SEQ ID No. 3 (the complement of GENBANK Accession No. NC_000005.10 truncated from truncated from nucleotides 177399001 to 177413000), and the human FXII mRNA sequence designated herein as SEQ ID No: 4 (GENBANK Accession No. NM 000505.3). ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular target sequence with 100% complementarity.

Cultured Huh7 cells, at a density of 20,000 cells per well, were transfected using electroporation with either 5000 nM or 2000 nM modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and FXII RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS40528 (described herein above) was used to measure RNA levels. FXII RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of FXII RNA is presented in the tables below as percent FXII RNA relative to the amount in untreated control cells (% UTC). The symbol “” indicates that the modified oligonucleotide is complementary to the target transcript within the amplicon region of the primer probe set. In such instances, additional assays using alternative primer probes must be performed to accurately assess the potency and efficacy of such modified oligonucleotides.

TABLE 12
Reduction of FXII RNA by 5-10-5 MOE gapmers with
mixed PO/PS internucleoside linkages (Huh7,
 electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1130742221221TCCAGGAGTCCAGATCAATA67620
113077037563756CCCTCATGGCATCCGTCCGT68621
11307988410384103AAGTGTTGACTCCAAGCTCA90622
1130826142161509528CTGTGTGCTCTTCAGCTTTG13623
113085417819735293548GGAAGTGGCAGGGCTCCCCG47624
113087121623535673586GGTACATTTGTGGTACAGCT18183
113088323225135833602CTGGCCGGCCCTTGTGGGTA21625
113091129731638043823CAAACAGTATCCCCATCGCT28626
113093933835741464165GGGCTGTGTTTGCTGCAGTG22627
113096741042942184237CCAGTGAGGTGTTGTGGACA68628
113099545347243984417GAGAAGCTGAGGCTCAAAGC38629
113102349851744434462TGCTTGCTCAGTTCTATACC20630
113105153855744834502AGTGGGCATCAGGACCCTTG93277
1131079573592N/AN/AGTTGGTGCGGCAGGCCTGGC37631
113110761363246974716GGCCCTCCACCTCTAGGCAG28632
113113565867747424761CGCAGAAGGCTCCGGTGTAG54633
113116371573449444963CCAGGCCGCGGTAGCTGAGC40634
113119176878749975016GGTGGCCTCCGAGGCCCACG83635
113121986488351785197GAAGCACCACGGGCGGATGT44636
113124790892752225241GCCAGGTCGCAGTACTCCCA19637
1131275999101853135332CGGCGGTGCCGGCTGCGCGG70638
11313031077109654965515AGGCGGCTGCTCCCGCTTCG38639
11313311123114255425561TGCGGAGCCGCTGCCCGCAG125640
11313591159117855785597GCCCGCCAACGACGCGGGTC56641
11313871230124956495668GCTGCCGGCGCAGAAACTGT57642
11314151316133559765995TGGCCGAGCACCACCGTCAG51643
11314431402142160626081AGCTGACGGGCGAGAAGGCC36644
11314711465148462086227ACAGGAGCGCGCAGCTGCCG30645
11314991553157262966315TGGTGGCCCCAGCCGGCCAC61646
11315271585160468836902GGAAGCTGGCATATTCCTCC57647
11315551660167969586977GGAGGATGGAGGATCCGTGC7648
11315831751177071397158GCAGCTTGGTCCTCACACAC8649
11316111798181771867205AGCCCGATCCCCAGCTGATG33650
11316391845186472337252GTAGTAGGCCACATCGGTGT62651
11316671877189672657284CAGGAAACGGTGTGCTCCCG28652
11316951921194073097328CACTGCGGAATCACCAAGGA13653
11317231956197573447363ACACAATCTTGCCTTCCATG26654
11317512012203174007419CTTTATTGAGTTCCTGCGCC2095
1131779N/AN/A109128TCCTGGTTCCCACAGCACTC71655
1131807N/AN/A193212CCTAGTCACCTGGACCCACA56656
1131835N/AN/A289308CAGAAATGCAGGCTGTGCCC71657
1131863N/AN/A386405TGCAGCTTCCTCTCACAGCC120658
1131891N/AN/A513532CCGACTGTGTGCTCTTCAGC21659
1131919N/AN/A618637ACCTAGCACCAGGTAGGCAC39660
1131947N/AN/A724743CTCAAGCACCTGCTCCGAGC54661
1131975N/AN/A874893GATCCTTCCTTGCCCATTGA122662
1132003N/AN/A972991TGAAGCTTGGAGAACTCAAA76663
1132031N/AN/A10791098AGCATTTCCATGCACCAGGT70664
1132059N/AN/A12121231GCCTGGCATGTAGGTAATTT60665
1132087N/AN/A15901609TGCTTAGAGACTCAACCCCA67666
1132115N/AN/A17621781AAGATGCAGATGGGATGGAC79667
1132143N/AN/A21382157AAAGTGCACTTGCCAAGGAC60668
1132171N/AN/A22682287AATGAGAATTGCCTGTGTCT41669
1132199N/AN/A23822401CAGATTATATGCTGTTGGTT49670
1132227N/AN/A25162535AAGGCTACCTTAGGGAGAAA48671
1132255N/AN/A26432662GAATGAGTGTCCTTCTCAGT46672
1132283N/AN/A27512770TTTTCATGGCCATTTGTGGG60673
1132311N/AN/A28482867AATAGTACAGTTGATCCTCA46674
1132339N/AN/A29592978GAAGAGCACTTGCCACAAAG106675
1132367N/AN/A30603079AAAAAAAACTTGGGTTCAGG133676
1132395N/AN/A34513470GCTCAGGCACTGTCCCTCAG41677
1132423N/AN/A36523671ACAGGCAGGGTACATGTCTC45678
1132451N/AN/A37613780GTAGCACACCTGTAGAAAGA45679
1132479N/AN/A39193938GTCCAGAATCCCAGGTGTGT46680
1132507N/AN/A40304049CTACTCCAAGTTTCCAAGCT97681
1132535N/AN/A41374156TTGCTGCAGTGGTCTGAGAG36682
1132563N/AN/A43284347TGCCAAGTCTCCGAGTATCC56683
1132591N/AN/A45634582CTCCTGCCAGCCTGTCTTCC70684
1132619N/AN/A47634782CAGACCCTCACTCACCCACG67685
1132647N/AN/A48784897GCTCCCTGGGCAGCCAAGGC37686
1132675N/AN/A53985417CCTCTCGGCTCCTCCTTCCC78687
1132703N/AN/A57665785TGGAAGCTGCGCTGGGAGAC122688
1132731N/AN/A61736192AGGCGCAACAGAGCTAACCC32689
1132759N/AN/A63886407GATACCAAAGTCGCGGGCTT100690
1132787N/AN/A65126531GTATCCCCAGGAGATTTGGG66691
1132815N/AN/A66366655CCCACCACCCATCCAGAGTC56692
1132843N/AN/A67276746GGTGCCATTAATTCAATTTC109693
1132871N/AN/A68686887CCTCCGCCCCTGCGAACACA55694
TABLE 13
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1130743322322ATCCAGGAGTCCAGATCAAT48695
113077138573857GCCCTCATGGCATCCGTCCG57696
11307998510485104AAAGTGTTGACTCCAAGCTC53697
1130827144163511530GACTGTGTGCTCTTCAGCTT32698
113085519721635483567TGCCGGTGGTACTGGAAGGG53699
113087121623535673586GGTACATTTGTGGTACAGCT13183
113088423325235843603CCTGGCCGGCCCTTGTGGGT50700
113091229831738053824CCAAACAGTATCCCCATCGC25701
113094035737641654184GGTCCCTCCTTTCTGGCAGG76702
113096841143042194238TCCAGTGAGGTGTTGTGGAC42703
113099645647544014420CCGGAGAAGCTGAGGCTCAA22704
113102449951844444463CTGCTTGCTCAGTTCTATAC14705
113105253955844844503CAGTGGGCATCAGGACCCTT46706
1131080574593N/AN/AGGTTGGTGCGGCAGGCCTGG22707
113110861563446994718GTGGCCCTCCACCTCTAGGC62708
113113666067947444763GTCGCAGAAGGCTCCGGTGT64709
113116471673549454964GCCAGGCCGCGGTAGCTGAG46710
113119277279150015020GGTAGGTGGCCTCCGAGGCC52711
113122086588451795198CGAAGCACCACGGGCGGATG95712
113124890992852235242TGCCAGGTCGCAGTACTCCC29713
11312761000101953145333TCGGCGGTGCCGGCTGCGCG39714
11313041078109754975516AAGGCGGCTGCTCCCGCTTC78715
11313321124114355435562TTGCGGAGCCGCTGCCCGCA65716
11313601161118055805599CAGCCCGCCAACGACGCGGG62717
11313881232125156515670AGGCTGCCGGCGCAGAAACT34718
11314161317133659775996CTGGCCGAGCACCACCGTCA13719
11314441405142460656084GGTAGCTGACGGGCGAGAAG48720
11314721467148662106229CGACAGGAGCGCGCAGCTGC59721
11315001554157362976316CTGGTGGCCCCAGCCGGCCA53722
11315281586160568846903AGGAAGCTGGCATATTCCTC47723
11315561679169869776996CCTGCGCAGAGCATGCCGGG7175
11315841752177171407159TGCAGCTTGGTCCTCACACA17724
11316121799181871877206CAGCCCGATCCCCAGCTGAT80725
11316401846186572347253GGTAGTAGGCCACATCGGTG19726
11316681878189772667285TCAGGAAACGGTGTGCTCCC46727
11316961922194173107329TCACTGCGGAATCACCAAGG21728
11317241958197773467365GGACACAATCTTGCCTTCCA7729
11317522013203274017420ACTTTATTGAGTTCCTGCGC11162
1131780N/AN/A112131CAATCCTGGTTCCCACAGCA64730
1131808N/AN/A196215CCTCCTAGTCACCTGGACCC60731
1131836N/AN/A292311CCCCAGAAATGCAGGCTGTG114732
1131864N/AN/A389408GTCTGCAGCTTCCTCTCACA56733
1131892N/AN/A516535TTACCGACTGTGTGCTCTTC18734
1131920N/AN/A621640AAGACCTAGCACCAGGTAGG58735
1131948N/AN/A727746TATCTCAAGCACCTGCTCCG25736
1131976N/AN/A877896CTTGATCCTTCCTTGCCCAT58737
1132004N/AN/A975994AATTGAAGCTTGGAGAACTC99738
1132032N/AN/A10821101TAAAGCATTTCCATGCACCA93739
1132060N/AN/A12151234CATGCCTGGCATGTAGGTAA53740
1132088N/AN/A15931612CCATGCTTAGAGACTCAACC82741
1132116N/AN/A17651784AAAAAGATGCAGATGGGATG86742
1132144N/AN/A21412160GGCAAAGTGCACTTGCCAAG85743
1132172N/AN/A22712290AATAATGAGAATTGCCTGTG117744
1132200N/AN/A23852404AACCAGATTATATGCTGTTG41745
1132228N/AN/A25192538AAGAAGGCTACCTTAGGGAG40746
1132256N/AN/A26462665ATTGAATGAGTGTCCTTCTC50747
1132284N/AN/A27542773ATGTTTTCATGGCCATTTGT45748
1132312N/AN/A28512870AATAATAGTACAGTTGATCC62749
1132340N/AN/A29622981CAGGAAGAGCACTTGCCACA52750
1132368N/AN/A33703389CTCTAAAAGTTGGGTTCAGG51751
1132396N/AN/A34573476TCAACTGCTCAGGCACTGTC53752
1132424N/AN/A36553674AGGACAGGCAGGGTACATGT51753
1132452N/AN/A37643783GTGGTAGCACACCTGTAGAA28754
1132480N/AN/A39223941TGGGTCCAGAATCCCAGGTG59755
1132508N/AN/A40334052TTGCTACTCCAAGTTTCCAA50756
1132536N/AN/A41404159TGTTTGCTGCAGTGGTCTGA21757
1132564N/AN/A43344353GGACCATGCCAAGTCTCCGA41758
1132592N/AN/A45664585GGCCTCCTGCCAGCCTGTCT49759
1132620N/AN/A47664785CCCCAGACCCTCACTCACCC90760
1132648N/AN/A48994918TGGTGTCTGAGGAGAAAGGG71761
1132676N/AN/A54015420CGCCCTCTCGGCTCCTCCTT44762
1132704N/AN/A58415860CTCCCCGGGAGCTCCGGAGG123763
1132732N/AN/A61766195TGAAGGCGCAACAGAGCTAA21764
1132760N/AN/A63946413CGGAACGATACCAAAGTCGC85765
1132788N/AN/A65156534CCTGTATCCCCAGGAGATTT21766
1132816N/AN/A66396658TCCCCCACCACCCATCCAGA87767
1132844N/AN/A67306749GGAGGTGCCATTAATTCAAT46768
1132872N/AN/A68716890ATTCCTCCGCCCCTGCGAAC150769
TABLE 14
Reduction of FXII RNA by 5-10-5 MOE gapmers with
mixed PO/PS internucleoside linkages (Huh7,
electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopFXIISEQ ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113080089108N/AN/AATCGAAAGTGTTGACTCCAA28770
1130828145164512531CGACTGTGTGCTCTTCAGCT14771
113085619921835503569GCTGCCGGTGGTACTGGAAG22772
113087121623535673586GGTACATTTGTGGTACAGCT21183
113088523425335853604GCCTGGCCGGCCCTTGTGGG51773
113091330432338113830TGGGCTCCAAACAGTATCCC22774
113094135937841674186CAGGTCCCTCCTTTCTGGCA46775
113096941343242214240TTTCCAGTGAGGTGTTGTGG25776
113099745747644024421ACCGGAGAAGCTGAGGCTCA19777
113102550051944454464GCTGCTTGCTCAGTTCTATA19778
113105354055944854504GCAGTGGGCATCAGGACCCT22779
1131081576595N/AN/ACGGGTTGGTGCGGCAGGCCT65780
113110961663547004719GGTGGCCCTCCACCTCTAGG38781
113113766168047454764CGTCGCAGAAGGCTCCGGTG94782
113116571773649464965GGCCAGGCCGCGGTAGCTGA35783
113119377379250025021CGGTAGGTGGCCTCCGAGGC30784
113122186788651815200CACGAAGCACCACGGGCGGA38785
113124991193052255244TGTGCCAGGTCGCAGTACTC24786
11312771001102053155334TTCGGCGGTGCCGGCTGCGC25787
11313051079109854985517GAAGGCGGCTGCTCCCGCTT39788
11313331126114555455564TCTTGCGGAGCCGCTGCCCG34789
11313611162118155815600CCAGCCCGCCAACGACGCGG31790
11313891233125256525671GAGGCTGCCGGCGCAGAAAC39791
11314171318133759785997CCTGGCCGAGCACCACCGTC26792
11314451408142760686087GCTGGTAGCTGACGGGCGAG26793
11314731468148762116230GCGACAGGAGCGCGCAGCTG21794
11315011555157462986317ACTGGTGGCCCCAGCCGGCC51795
11315291587160668856904CAGGAAGCTGGCATATTCCT82796
11315571680169969786997CCCTGCGCAGAGCATGCCGG 28797
11315851753177271417160CTGCAGCTTGGTCCTCACAC  6798
11316131800181971887207ACAGCCCGATCCCCAGCTGA39799
11316411847186672357254AGGTAGTAGGCCACATCGGT19800
11316691879189872677286ATCAGGAAACGGTGTGCTCC24801
11316971923194273117330CTCACTGCGGAATCACCAAG 8802
11317251960197973487367TGGGACACAATCTTGCCTTC12803
11317532014203374027421CACTTTATTGAGTTCCTGCG15163
1131781N/AN/A115134GGACAATCCTGGTTCCCACA71804
1131809N/AN/A199218AGGCCTCCTAGTCACCTGGA58805
1131837N/AN/A302321GGCCCATCTCCCCCAGAAAT50806
1131865N/AN/A392411CTAGTCTGCAGCTTCCTCTC48807
1131893N/AN/A519538CACTTACCGACTGTGTGCTC24808
1131921N/AN/A627646GGGCATAAGACCTAGCACCA46809
1131949N/AN/A730749ACATATCTCAAGCACCTGCT63810
1131977N/AN/A880899GCTCTTGATCCTTCCTTGCC54811
1132005N/AN/A9971016AACCTGGTTTCACAGAAGGG54812
1132033N/AN/A10851104TTGTAAAGCATTTCCATGCA37813
1132061N/AN/A15121531ACTCTAGGTAAATTTTTTTT86814
1132089N/AN/A16121631AATGTGCTGGGCCTCAACGC49815
1132117N/AN/A19081927AAGTTGTGTGCCTGTAATCC50816
1132145N/AN/A21442163CAAGGCAAAGTGCACTTGCC39817
1132173N/AN/A22742293GCGAATAATGAGAATTGCCT38818
1132201N/AN/A23882407TAAAACCAGATTATATGCTG67819
1132229N/AN/A25222541CACAAGAAGGCTACCTTAGG55820
1132257N/AN/A26492668CCTATTGAATGAGTGTCCTT48821
1132285N/AN/A27602779CTTGAAATGTTTTCATGGCC59822
1132313N/AN/A28542873AGTAATAATAGTACAGTTGA59823
1132341N/AN/A29652984GGCCAGGAAGAGCACTTGCC59824
1132369N/AN/A33733392CTGCTCTAAAAGTTGGGTTC40825
1132397N/AN/A34603479TACTCAACTGCTCAGGCACT34826
1132425N/AN/A36583677AGAAGGACAGGCAGGGTACA67827
1132453N/AN/A38243843CCTTTCACTTTCTTGGGCTC16828
1132481N/AN/A39253944GGCTGGGTCCAGAATCCCAG40829
1132509N/AN/A40364055ACCTTGCTACTCCAAGTTTC36830
1132537N/AN/A42364255CCTTTCTGGCAGTGGTTTCC20831
1132565N/AN/A43374356CTAGGACCATGCCAAGTCTC89832
1132593N/AN/A45694588CCCGGCCTCCTGCCAGCCTG40833
1132621N/AN/A47694788TTGCCCCAGACCCTCACTCA47834
1132649N/AN/A49024921CCTTGGTGTCTGAGGAGAAA59835
1132677N/AN/A54185437GAATCTAGCTCGCCCGGCGC58836
1132705N/AN/A58445863TTCCTCCCCGGGAGCTCCGG65837
1132733N/AN/A63066325ACCCTCGAACTGGTGGCCCC59838
1132761N/AN/A63976416ACCCGGAACGATACCAAAGT61839
1132789N/AN/A65186537CTCCCTGTATCCCCAGGAGA77840
1132817N/AN/A66436662CCCCTCCCCCACCACCCATC46841
1132845N/AN/A67336752GGAGGAGGTGCCATTAATTC61842
1132873N/AN/A68746893CATATTCCTCCGCCCCTGCG90843
TABLE 15
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation,
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopFXIISEQ ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1130745524524CTATCCAGGAGTCCAGATCA58844
113077342614261CAGAGCCCTCATGGCATCCG33845
113080190109N/AN/AAATCGAAAGTGTTGACTCCA33846
1130829146165N/AN/AACGACTGTGTGCTCTTCAGC20176
113085720021935513570AGCTGCCGGTGGTACTGGAA43847
113087121623535673586GGTACATTTGTGGTACAGCT18183
113088623525435863605GGCCTGGCCGGCCCTTGTGG49848
113091430532438123831TTGGGCTCCAAACAGTATCC20849
113094236138041694188CACAGGTCCCTCCTTTCTGG62850
113097041743642254244GTGGTTTCCAGTGAGGTGTT19851
113099845947844044423AAACCGGAGAAGCTGAGGCT21852
113102650152044464465AGCTGCTTGCTCAGTTCTAT41853
113105454256144874506TGGCAGTGGGCATCAGGACC60854
1131082577596N/AN/AACGGGTTGGTGCGGCAGGCC31855
113111061763647014720CGGTGGCCCTCCACCTCTAG44856
1131138679698N/AN/AAGCTTGCCTTGGTGTCCACG38857
113116671973849484967CTGGCCAGGCCGCGGTAGCT92858
113119477479350035022CCGGTAGGTGGCCTCCGAGG44859
113122286888751825201GCACGAAGCACCACGGGCGG30860
113125091293152265245CTGTGCCAGGTCGCAGTACT38861
11312781003102253175336GCTTCGGCGGTGCCGGCTGC33862
11313061080109954995518GGAAGGCGGCTGCTCCCGCT36863
11313341127114655465565CTCTTGCGGAGCCGCTGCCC46864
11313621164118355835602CACCAGCCCGCCAACGACGC24865
11313901234125356535672TGAGGCTGCCGGCGCAGAAA40866
11314181319133859795998TCCTGGCCGAGCACCACCGT34867
11314461410142960706089GTGCTGGTAGCTGACGGGCG26868
11314741470148962136232AGGCGACAGGAGCGCGCAGC21869
11315021556157562996318AACTGGTGGCCCCAGCCGGC47870
11315301588160768866905GCAGGAAGCTGGCATATTCC58871
11315581681170069796998ACCCTGCGCAGAGCATGCCG 20872
11315861755177471437162CTCTGCAGCTTGGTCCTCAC 14873
11316141801182071897208CACAGCCCGATCCCCAGCTG38874
11316421848186772367255CAGGTAGTAGGCCACATCGG35875
11316701881190072697288CAATCAGGAAACGGTGTGCT47876
11316981924194373127331TCTCACTGCGGAATCACCAA 6877
11317261961198073497368ATGGGACACAATCTTGCCTT34878
11317542015203474037422GCACTTTATTGAGTTCCTGC 4164
1131782N/AN/A118137CTGGGACAATCCTGGTTCCC56879
1131810N/AN/A202221CATAGGCCTCCTAGTCACCT94880
1131838N/AN/A305324TAAGGCCCATCTCCCCCAGA41881
1131866N/AN/A395414TTGCTAGTCTGCAGCTTCCT60882
1131894N/AN/A523542AGGCCACTTACCGACTGTGT109 883
1131922N/AN/A630649CATGGGCATAAGACCTAGCA65884
1131950N/AN/A733752AGCACATATCTCAAGCACCT85885
1131978N/AN/A886905AGACAAGCTCTTGATCCTTC79886
1132006N/AN/A10001019ATCAACCTGGTTTCACAGAA48887
1132034N/AN/A10881107TATTTGTAAAGCATTTCCAT67888
1132062N/AN/A15151534CACACTCTAGGTAAATTTTT59889
1132090N/AN/A16151634TGGAATGTGCTGGGCCTCAA59890
1132118N/AN/A19111930ATGAAGTTGTGTGCCTGTAA61891
1132146N/AN/A21472166GTTCAAGGCAAAGTGCACTT56892
1132174N/AN/A22772296ATCGCGAATAATGAGAATTG68893
1132202N/AN/A23912410ACATAAAACCAGATTATATG52894
1132230N/AN/A25252544AAGCACAAGAAGGCTACCTT33895
1132258N/AN/A26522671TCTCCTATTGAATGAGTGTC36896
1132286N/AN/A27652784CAATACTTGAAATGTTTTCA47897
1132314N/AN/A28572876GGCAGTAATAATAGTACAGT38898
1132342N/AN/A29682987CAAGGCCAGGAAGAGCACTT76899
1132370N/AN/A33763395TTTCTGCTCTAAAAGTTGGG35900
1132398N/AN/A34633482CTGTACTCAACTGCTCAGGC60901
1132426N/AN/A36613680GACAGAAGGACAGGCAGGGT52902
1132454N/AN/A38273846GCACCTTTCACTTTCTTGGG24903
1132482N/AN/A39453964TATTGTGGAGGGAGAGAAGG83904
1132510N/AN/A40394058GTGACCTTGCTACTCCAAGT74905
1132538N/AN/A42394258TCACCTTTCTGGCAGTGGTT44906
1132566N/AN/A43404359AGTCTAGGACCATGCCAAGT34907
1132594N/AN/A45724591CCACCCGGCCTCCTGCCAGC75908
1132622N/AN/A47724791TGCTTGCCCCAGACCCTCAC54909
1132650N/AN/A49054924TTGCCTTGGTGTCTGAGGAG44910
1132678N/AN/A54215440CCGGAATCTAGCTCGCCCGG50911
1132706N/AN/A58475866AGCTTCCTCCCCGGGAGCTC64912
1132734N/AN/A63096328CCTACCCTCGAACTGGTGGC61913
1132762N/AN/A64006419GGCACCCGGAACGATACCAA63914
1132790N/AN/A65216540ATTCTCCCTGTATCCCCAGG58915
1132818N/AN/A66466665AAACCCCTCCCCCACCACCC41916
1132846N/AN/A67526771CTCGCAGCAAGCCCGAAGGG38917
1132874N/AN/A68776896TGGCATATTCCTCCGCCCCT49918
TABLE 16
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation,
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopFXIISEQ ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1130746726726GCCTATCCAGGAGTCCAGAT29919
113077446654665GCAGCAGAGCCCTCATGGCA22920
113080291110N/AN/AGAATCGAAAGTGTTGACTCC40921
1130830147166N/AN/AAACGACTGTGTGCTCTTCAG 9922
113085820122035523571CAGCTGCCGGTGGTACTGGA22923
113087121623535673586GGTACATTTGTGGTACAGCT22183
113088723625535873606GGGCCTGGCCGGCCCTTGTG41924
113091530632538133832CTTGGGCTCCAAACAGTATC26925
113094336238141704189ACACAGGTCCCTCCTTTCTG32926
113097141943842274246CAGTGGTTTCCAGTGAGGTG38927
113099946047944054424AAAACCGGAGAAGCTGAGGC26928
113102750252144474466CAGCTGCTTGCTCAGTTCTA35929
113105554356244884507CTGGCAGTGGGCATCAGGAC33930
113108357959846634682GCACGGGTTGGTGCGGCAGG29931
113111161863747024721GCGGTGGCCCTCCACCTCTA54932
1131139680699N/AN/ACAGCTTGCCTTGGTGTCCAC30933
113116772073949494968CCTGGCCAGGCCGCGGTAGC80934
113119577579450045023TCCGGTAGGTGGCCTCCGAG33935
113122386988851835202AGCACGAAGCACCACGGGCG17936
113125191393252275246ACTGTGCCAGGTCGCAGTAC26937
11312791004102353185337GGCTTCGGCGGTGCCGGCTG24938
11313071081110055005519GGGAAGGCGGCTGCTCCCGC40939
11313351128114755475566ACTCTTGCGGAGCCGCTGCC4398
11313631165118455845603CCACCAGCCCGCCAACGACG59940
11313911235125456545673ATGAGGCTGCCGGCGCAGAA49941
11314191320133959805999TTCCTGGCCGAGCACCACCG24942
11314471411143060716090CGTGCTGGTAGCTGACGGGC25943
11314751471149062146233AAGGCGACAGGAGCGCGCAG28944
11315031557157663006319GAACTGGTGGCCCCAGCCGG65945
11315311592161168906909TCCTGCAGGAAGCTGGCATA88946
11315591683170269817000GAACCCTGCGCAGAGCATGC 56947
11315871757177671457164CGCTCTGCAGCTTGGTCCTC 19948
11316151802182171907209CCACAGCCCGATCCCCAGCT40949
11316431849186872377256CCAGGTAGTAGGCCACATCG4488
11316711882190172707289GCAATCAGGAAACGGTGTGC12950
11316991926194573147333TCTCTCACTGCGGAATCACC 7951
11317271962198173507369AATGGGACACAATCTTGCCT25952
11317552016203574047423AGCACTTTATTGAGTTCCTG 3953
1131783N/AN/A121140ATCCTGGGACAATCCTGGTT41954
1131811N/AN/A205224CCACATAGGCCTCCTAGTCA48955
1131839N/AN/A308327TCTTAAGGCCCATCTCCCCC46956
1131867N/AN/A398417CTGTTGCTAGTCTGCAGCTT85957
1131895N/AN/A526545GCCAGGCCACTTACCGACTG40958
1131923N/AN/A633652GCCCATGGGCATAAGACCTA37959
1131951N/AN/A736755AGCAGCACATATCTCAAGCA68960
1131979N/AN/A889908CAGAGACAAGCTCTTGATCC44961
1132007N/AN/A10031022GTTATCAACCTGGTTTCACA27962
1132035N/AN/A10971116AAAAGCTAATATTTGTAAAG42963
1132063N/AN/A15181537TGCCACACTCTAGGTAAATT43964
1132091N/AN/A16181637GGTTGGAATGTGCTGGGCCT48965
1132119N/AN/A19141933AGCATGAAGTTGTGTGCCTG79966
1132147N/AN/A21502169TTTGTTCAAGGCAAAGTGCA34967
1132175N/AN/A22802299ACCATCGCGAATAATGAGAA32968
1132203N/AN/A23942413CATACATAAAACCAGATTAT67969
1132231N/AN/A25332552TAGTTCCTAAGCACAAGAAG98970
1132259N/AN/A26552674AGCTCTCCTATTGAATGAGT36971
1132287N/AN/A27682787AGTCAATACTTGAAATGTTT84972
1132315N/AN/A28602879AACGGCAGTAATAATAGTAC55973
1132343N/AN/A29712990TCCCAAGGCCAGGAAGAGCA32974
1132371N/AN/A33793398CACTTTCTGCTCTAAAAGTT28975
1132399N/AN/A34663485CCCCTGTACTCAACTGCTCA42976
1132427N/AN/A36643683TTGGACAGAAGGACAGGCAG58977
1132455N/AN/A38303849GTAGCACCTTTCACTTTCTT16978
1132483N/AN/A39543973TCCAAAGGGTATTGTGGAGG38979
1132511N/AN/A40424061CTTGTGACCTTGCTACTCCA28980
1132539N/AN/A42424261TCCTCACCTTTCTGGCAGTG27981
1132567N/AN/A43434362GAGAGTCTAGGACCATGCCA80982
1132595N/AN/A45754594ACACCACCCGGCCTCCTGCC58983
1132623N/AN/A47754794TTCTGCTTGCCCCAGACCCT70984
1132651N/AN/A49084927AGCTTGCCTTGGTGTCTGAG19985
1132679N/AN/A54245443TGGCCGGAATCTAGCTCGCC61986
1132707N/AN/A58505869TCCAGCTTCCTCCCCGGGAG51987
1132735N/AN/A63126331GTGCCTACCCTCGAACTGGT45988
1132763N/AN/A64036422GTAGGCACCCGGAACGATAC27989
1132791N/AN/A65246543TCGATTCTCCCTGTATCCCC69990
1132819N/AN/A66496668CAGAAACCCCTCCCCCACCA50991
1132847N/AN/A67556774TCTCTCGCAGCAAGCCCGAA48992
1132875N/AN/A70107029ACCTGGCACGCATCGGTGCC 29993
TABLE 17
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation,
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopFXIISEQ ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113074710291029GCTGCCTATCCAGGAGTCCA45994
113077547664766AGCAGCAGAGCCCTCATGGC43995
113080393112N/AN/ATGGAATCGAAAGTGTTGACT25996
1130831148167N/AN/AGAACGACTGTGTGCTCTTCA18997
113085920322235543573TACAGCTGCCGGTGGTACTG28998
113087121623535673586GGTACATTTGTGGTACAGCT 8183
113088823825735893608GAGGGCCTGGCCGGCCCTTG77999
113091630732638143833TCTTGGGCTCCAAACAGTAT331000
113094436338241714190CACACAGGTCCCTCCTTTCT531001
113097242043942284247GCAGTGGTTTCCAGTGAGGT191002
113100046148044064425AAAAACCGGAGAAGCTGAGG251003
113102850552444504469CCACAGCTGCTTGCTCAGTT231004
113105654556444904509CGCTGGCAGTGGGCATCAGG241005
113108458059946644683GGCACGGGTTGGTGCGGCAG191006
113111261963847034722GGCGGTGGCCCTCCACCTCT361007
1131140681700N/AN/AGCAGCTTGCCTTGGTGTCCA211008
113116872174049504969TCCTGGCCAGGCCGCGGTAG371009
113119677779650065025GTTCCGGTAGGTGGCCTCCG461010
113122487088951845203CAGCACGAAGCACCACGGGC351011
113125291493352285247CACTGTGCCAGGTCGCAGTA601012
11312801005102453195338AGGCTTCGGCGGTGCCGGCT311013
11313081085110455045523GTCAGGGAAGGCGGCTGCTC251014
11313361129114855485567GACTCTTGCGGAGCCGCTGC401015
11313641167118655865605CGCCACCAGCCCGCCAACGA431016
11313921237125656565675CGATGAGGCTGCCGGCGCAG301017
11314201322134159826001CGTTCCTGGCCGAGCACCAC341018
113144814301449N/AN/AAGGCGCAACAGAGCCAGGTC381019
11314761473149262166235GTAAGGCGACAGGAGCGCGC371020
11315041558157763016320CGAACTGGTGGCCCCAGCCG761021
11315321594161368926911CCTCCTGCAGGAAGCTGGCA112 1022
11315601687170669857004CGAGGAACCCTGCGCAGAGC 61023
11315881758177771467165GCGCTCTGCAGCTTGGTCCT 161024
11316161803182271917210ACCACAGCCCGATCCCCAGC391025
11316441850186972387257GCCAGGTAGTAGGCCACATC341026
11316721883190272717290AGCAATCAGGAAACGGTGTG241027
11317001927194673157334CTCTCTCACTGCGGAATCAC 71028
11317281963198273517370GAATGGGACACAATCTTGCC211029
11317562017203674057424AAGCACTTTATTGAGTTCCT 51030
1131784N/AN/A124143ACAATCCTGGGACAATCCTG851031
1131812N/AN/A208227TTTCCACATAGGCCTCCTAG421032
1131840N/AN/A311330TCTTCTTAAGGCCCATCTCC791033
1131868N/AN/A401420GATCTGTTGCTAGTCTGCAG821034
1131896N/AN/A529548GGAGCCAGGCCACTTACCGA451035
1131924N/AN/A636655AGTGCCCATGGGCATAAGAC521036
1131952N/AN/A739758GCCAGCAGCACATATCTCAA551037
1131980N/AN/A892911TGCCAGAGACAAGCTCTTGA731038
1132008N/AN/A10061025ACTGTTATCAACCTGGTTTC601039
1132036N/AN/A11051124TTCATAATAAAAGCTAATAT681040
1132064N/AN/A15211540ATGTGCCACACTCTAGGTAA511041
1132092N/AN/A16221641CCAGGGTTGGAATGTGCTGG561042
1132120N/AN/A19171936CTGAGCATGAAGTTGTGTGC441043
1132148N/AN/A21662185AAGCTTTTGCCACTATTTTG361044
1132176N/AN/A22832302ATAACCATCGCGAATAATGA501045
1132204N/AN/A23972416AATCATACATAAAACCAGAT751046
1132232N/AN/A25362555GTGTAGTTCCTAAGCACAAG371047
1132260N/AN/A26582677TTCAGCTCTCCTATTGAATG371048
1132288N/AN/A27712790CCAAGTCAATACTTGAAATG421049
1132316N/AN/A28632882TAAAACGGCAGTAATAATAG621050
1132344N/AN/A29742993CAGTCCCAAGGCCAGGAAGA381051
1132372N/AN/A33823401AAACACTTTCTGCTCTAAAA671052
1132400N/AN/A34693488CTTCCCCTGTACTCAACTGC431053
1132428N/AN/A36673686TCCTTGGACAGAAGGACAGG751054
1132456N/AN/A38333852TGTGTAGCACCTTTCACTTT411055
1132484N/AN/A39573976ACTTCCAAAGGGTATTGTGG561056
1132512N/AN/A40454064TGCCTTGTGACCTTGCTACT341057
1132540N/AN/A42454264ATCTCCTCACCTTTCTGGCA821058
1132568N/AN/A43464365CAGGAGAGTCTAGGACCATG781059
1132596N/AN/A45784597GGCACACCACCCGGCCTCCT481060
1132624N/AN/A47784797GCCTTCTGCTTGCCCCAGAC481061
1132652N/AN/A49114930AGCAGCTTGCCTTGGTGTCT251062
1132680N/AN/A54275446GGCTGGCCGGAATCTAGCTC691063
1132708N/AN/A58535872TGTTCCAGCTTCCTCCCCGG371064
1132736N/AN/A63156334GTTGTGCCTACCCTCGAACT851065
1132764N/AN/A64066425TCTGTAGGCACCCGGAACGA581066
1132792N/AN/A65276546AGTTCGATTCTCCCTGTATC541067
1132820N/AN/A66526671AAACAGAAACCCCTCCCCCA731068
1132848N/AN/A67586777TCCTCTCTCGCAGCAAGCCC571069
1132876N/AN/A70137032CTCACCTGGCACGCATCGGT 641070
TABLE 18
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation,
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopFXIISEQ ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113074912311231CAGCTGCCTATCCAGGAGTC571071
113077749684968GGAGCAGCAGAGCCCTCATG401072
113080596115N/AN/AAGGTGGAATCGAAAGTGTTG341073
1130833151170N/AN/ATGAGAACGACTGTGTGCTCT271074
113086120522435563575GGTACAGCTGCCGGTGGTAC311075
113087121623535673586GGTACATTTGTGGTACAGCT10183
113089024025935913610CTGAGGGCCTGGCCGGCCCT401076
113091831032938173836CTTTCTTGGGCTCCAAACAG361077
113094636638541744193GTTCACACAGGTCCCTCCTT481078
113097442344242314250CTGGCAGTGGTTTCCAGTGA281079
113100246448344094428TGGAAAAACCGGAGAAGCTG221080
113103050852744534472TGGCCACAGCTGCTTGCTCA481081
113105854756644924511GCCGCTGGCAGTGGGCATCA421082
113108658360246674686GGAGGCACGGGTTGGTGCGG271083
113111462264147064725ACAGGCGGTGGCCCTCCACC581084
113114268570449144933CATAGCAGCTTGCCTTGGTG221085
113117072474349534972TGGTCCTGGCCAGGCCGCGG771086
113119879681550255044GCGCTTGCTCGGCAGTCACG181087
113122687389251875206GTTCAGCACGAAGCACCACG211088
113125491693552305249GGCACTGTGCCAGGTCGCAG391089
11312821007102653215340TGAGGCTTCGGCGGTGCCGG431090
11313101089110855085527CCTGGTCAGGGAAGGCGGCT271091
11313381131115055505569CAGACTCTTGCGGAGCCGCT221092
11313661203122256225641GTACAGCGCGGCGATGTAGG411093
11313941239125856585677GGCGATGAGGCTGCCGGCGC31114
11314221341136060016020CTCACAGCTGTGGTTACGGC231094
113145014331452N/AN/ATGAAGGCGCAACAGAGCCAG461095
11314781492151162356254GCAGGCACACCGGCTGAACG3672
11315061560157963036322CTCGAACTGGTGGCCCCAGC531096
11315341597161668956914GCGCCTCCTGCAGGAAGCTG921097
11315621690170969887007CCTCGAGGAACCCTGCGCAG 271098
11315901776179571647183GCCTTGCAGGGTGAGCCGGC431099
11316181805182471937212TCACCACAGCCCGATCCCCA401100
11316461852187172407259AGGCCAGGTAGTAGGCCACA631101
11316741888190772767295CCCTGAGCAATCAGGAAACG351102
11317021930194973187337CCACTCTCTCACTGCGGAAT 91103
11317301984200373727391GCGGAGCTGGCCGCACTGGG181104
11317582019203874077426CAAAGCACTTTATTGAGTTC 91105
1131786N/AN/A130149CCCAGAACAATCCTGGGACA701106
1131814N/AN/A214233CTCACCTTTCCACATAGGCC821107
1131842N/AN/A317336CCGTTGTCTTCTTAAGGCCC821108
1131870N/AN/A407426GCCACCGATCTGTTGCTAGT671109
1131898N/AN/A538557CCGGGAGGAGGAGCCAGGCC671110
1131926N/AN/A642661CACTCTAGTGCCCATGGGCA831111
1131954N/AN/A760779CAGGAGCCCAGGTGTGATGG471112
1131982N/AN/A898917TTCAGATGCCAGAGACAAGC541113
1132010N/AN/A10121031AGGTTTACTGTTATCAACCT481114
1132038N/AN/A11111130GGTAGTTTCATAATAAAAGC361115
1132066N/AN/A15271546CCTGCTATGTGCCACACTCT591116
1132094N/AN/A16371656GGAGGCTGAGGGAGTCCAGG901117
1132122N/AN/A19231942AATTAGCTGAGCATGAAGTT541118
1132150N/AN/A21722191CTCAATAAGCTTTTGCCACT571119
1132178N/AN/A22892308TAGAACATAACCATCGCGAA331120
1132206N/AN/A24112430ATGTCTTTAAACAGAATCAT321121
1132234N/AN/A25422561AGAGCTGTGTAGTTCCTAAG651122
1132262N/AN/A26642683GCTTGTTTCAGCTCTCCTAT781123
1132290N/AN/A27772796TAACTCCCAAGTCAATACTT761124
1132318N/AN/A28902909TGATCTGAGCCTTGGTTTCC691125
1132346N/AN/A29802999AGTCTTCAGTCCCAAGGCCA711126
1132374N/AN/A33883407CATTGAAAACACTTTCTGCT701127
1132402N/AN/A34753494TGAGGACTTCCCCTGTACTC401128
1132430N/AN/A36733692CAGAGTTCCTTGGACAGAAG381129
1132458N/AN/A38393858AGGCTGTGTGTAGCACCTTT541130
1132486N/AN/A39633982CTCTGGACTTCCAAAGGGTA371131
1132514N/AN/A40514070CCTACTTGCCTTGTGACCTT371132
1132542N/AN/A42514270CTCCACATCTCCTCACCTTT391133
1132570N/AN/A43524371TGGTCTCAGGAGAGTCTAGG591134
1132598N/AN/A45844603CTTCCTGGCACACCACCCGG601135
1132626N/AN/A47844803GGGCTGGCCTTCTGCTTGCC361136
1132654N/AN/A50705089ACGCGGCGCACCGGCAGAAG611137
1132682N/AN/A54365455CCCGCGGCCGGCTGGCCGGA118 1138
1132710N/AN/A58595878ATCCCGTGTTCCAGCTTCCT671139
1132738N/AN/A63216340CTAGCAGTTGTGCCTACCCT491140
1132766N/AN/A64126431ACCCATTCTGTAGGCACCCG781141
1132794N/AN/A65336552AGAGCAAGTTCGATTCTCCC881142
1132822N/AN/A66586677GAGCGGAAACAGAAACCCCT521143
1132850N/AN/A67646783TGCCCTTCCTCTCTCGCAGC951144
1132878N/AN/A70197038TAAGAGCTCACCTGGCACGC 851145
TABLE 19
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation,
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopFXIISEQ ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113074811301130AGCTGCCTATCCAGGAGTCC621146
113077648674867GAGCAGCAGAGCCCTCATGG671147
113080494113N/AN/AGTGGAATCGAAAGTGTTGAC581148
1130832150169N/AN/AGAGAACGACTGTGTGCTCTT121149
113086020422335553574GTACAGCTGCCGGTGGTACT351150
113087121623535673586GGTACATTTGTGGTACAGCT16183
113088923925835903609TGAGGGCCTGGCCGGCCCTT541151
113091730832738153834TTCTTGGGCTCCAAACAGTA251152
113094536538441734192TTCACACAGGTCCCTCCTTT371153
113097342144042294248GGCAGTGGTTTCCAGTGAGG141154
113100146348244084427GGAAAAACCGGAGAAGCTGA261155
113102950652544514470GCCACAGCTGCTTGCTCAGT351156
113105754656544914510CCGCTGGCAGTGGGCATCAG321157
113108558260146664685GAGGCACGGGTTGGTGCGGC321158
113111362164047054724CAGGCGGTGGCCCTCCACCT251159
1131141682701N/AN/AAGCAGCTTGCCTTGGTGTCC291160
113116972274149514970GTCCTGGCCAGGCCGCGGTA421161
113119777879750075026CGTTCCGGTAGGTGGCCTCC281162
113122587289151865205TTCAGCACGAAGCACCACGG271163
113125391593452295248GCACTGTGCCAGGTCGCAGT361164
11312811006102553205339GAGGCTTCGGCGGTGCCGGC261165
11313091087110655065525TGGTCAGGGAAGGCGGCTGC 81166
11313371130114955495568AGACTCTTGCGGAGCCGCTG241167
11313651168118755875606GCGCCACCAGCCCGCCAACG331168
11313931238125756575676GCGATGAGGCTGCCGGCGCA261169
11314211340135960006019TCACAGCTGTGGTTACGGCG381170
113144914311450N/AN/AAAGGCGCAACAGAGCCAGGT551171
11314771474149362176236CGTAAGGCGACAGGAGCGCG251172
11315051559157863026321TCGAACTGGTGGCCCCAGCC8674
11315331595161468936912GCCTCCTGCAGGAAGCTGGC531173
11315611688170769867005TCGAGGAACCCTGCGCAGAG 211174
11315891775179471637182CCTTGCAGGGTGAGCCGGCG301175
11316171804182371927211CACCACAGCCCGATCCCCAG281176
11316451851187072397258GGCCAGGTAGTAGGCCACAT631177
11316731886190572747293CTGAGCAATCAGGAAACGGT161178
11317011928194773167335ACTCTCTCACTGCGGAATCA 71179
11317291964198373527371GGAATGGGACACAATCTTGC261180
11317572018203774067425AAAGCACTTTATTGAGTTCC 3165
1131785N/AN/A127146AGAACAATCCTGGGACAATC691181
1131813N/AN/A211230ACCTTTCCACATAGGCCTCC991182
1131841N/AN/A314333TTGTCTTCTTAAGGCCCATC491183
1131869N/AN/A404423ACCGATCTGTTGCTAGTCTG721184
1131897N/AN/A535554GGAGGAGGAGCCAGGCCACT941185
1131925N/AN/A639658TCTAGTGCCCATGGGCATAA381186
1131953N/AN/A757776GAGCCCAGGTGTGATGGCGC871187
1131981N/AN/A895914AGATGCCAGAGACAAGCTCT491188
1132009N/AN/A10091028TTTACTGTTATCAACCTGGT381189
1132037N/AN/A11081127AGTTTCATAATAAAAGCTAA831190
1132065N/AN/A15241543GCTATGTGCCACACTCTAGG102 1191
1132093N/AN/A16251644AGTCCAGGGTTGGAATGTGC801192
1132121N/AN/A19201939TAGCTGAGCATGAAGTTGTG521193
1132149N/AN/A21692188AATAAGCTTTTGCCACTATT591194
1132177N/AN/A22862305AACATAACCATCGCGAATAA531195
1132205N/AN/A24002419CAGAATCATACATAAAACCA451196
1132233N/AN/A25392558GCTGTGTAGTTCCTAAGCAC701197
1132261N/AN/A26612680TGTTTCAGCTCTCCTATTGA531198
1132289N/AN/A27742793CTCCCAAGTCAATACTTGAA931199
1132317N/AN/A28702889TTATCTGTAAAACGGCAGTA381200
1132345N/AN/A29772996CTTCAGTCCCAAGGCCAGGA641201
1132373N/AN/A33853404TGAAAACACTTTCTGCTCTA511202
1132401N/AN/A34723491GGACTTCCCCTGTACTCAAC721203
1132429N/AN/A36703689AGTTCCTTGGACAGAAGGAC501204
1132457N/AN/A38363855CTGTGTGTAGCACCTTTCAC731205
1132485N/AN/A39603979TGGACTTCCAAAGGGTATTG391206
1132513N/AN/A40484067ACTTGCCTTGTGACCTTGCT581207
1132541N/AN/A42484267CACATCTCCTCACCTTTCTG981208
1132569N/AN/A43494368TCTCAGGAGAGTCTAGGACC591209
1132597N/AN/A45814600CCTGGCACACCACCCGGCCT701210
1132625N/AN/A47814800CTGGCCTTCTGCTTGCCCCA461211
1132653N/AN/A50675086CGGCGCACCGGCAGAAGGCG371212
1132681N/AN/A54305449GCCGGCTGGCCGGAATCTAG771213
1132709N/AN/A58565875CCGTGTTCCAGCTTCCTCCC160 1214
1132737N/AN/A63186337GCAGTTGTGCCTACCCTCGA491215
1132765N/AN/A64096428CATTCTGTAGGCACCCGGAA471216
1132793N/AN/A65306549GCAAGTTCGATTCTCCCTGT721217
1132821N/AN/A66556674CGGAAACAGAAACCCCTCCC471218
1132849N/AN/A67616780CCTTCCTCTCTCGCAGCAAG591219
1132877N/AN/A70167035GAGCTCACCTGGCACGCATC 851220
TABLE 20
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation,
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopFXIISEQ ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113075013321332CCAGCTGCCTATCCAGGAGT481221
113077850695069AGGAGCAGCAGAGCCCTCAT381222
113080697116N/AN/AAAGGTGGAATCGAAAGTGTT671223
1130834152171N/AN/AGTGAGAACGACTGTGTGCTC201224
113086220622535573576TGGTACAGCTGCCGGTGGTA261225
113087121623535673586GGTACATTTGTGGTACAGCT13183
113089124126035923611GCTGAGGGCCTGGCCGGCCC511226
113091931133038183837ACTTTCTTGGGCTCCAAACA491227
113094736738641754194TGTTCACACAGGTCCCTCCT281228
113097542644542344253TTTCTGGCAGTGGTTTCCAG241229
113100346948844144433TCTTGTGGAAAAACCGGAGA361230
113103150952844544473CTGGCCACAGCTGCTTGCTC461231
113105954956844944513CAGCCGCTGGCAGTGGGCAT711232
113108758560446694688ATGGAGGCACGGGTTGGTGC641233
113111562464347084727GCACAGGCGGTGGCCCTCCA341234
113114368670549154934TCATAGCAGCTTGCCTTGGT281235
113117172574449544973GTGGTCCTGGCCAGGCCGCG641236
113119979781650265045CGCGCTTGCTCGGCAGTCAC171237
113122787489351885207GGTTCAGCACGAAGCACCAC231238
113125591793652315250TGGCACTGTGCCAGGTCGCA181239
11312831008102753225341CTGAGGCTTCGGCGGTGCCG211240
11313111090110955095528TCCTGGTCAGGGAAGGCGGC261241
11313391132115155515570ACAGACTCTTGCGGAGCCGC2060
11313671204122356235642AGTACAGCGCGGCGATGTAG421242
11313951240125956595678GGGCGATGAGGCTGCCGGCG531243
11314231342136160026021GCTCACAGCTGTGGTTACGG191244
113145114341453N/AN/ACTGAAGGCGCAACAGAGCCA461245
11314791493151262366255GGCAGGCACACCGGCTGAAC311246
11315071561158063046323CCTCGAACTGGTGGCCCCAG153 1247
11315351598161768966915TGCGCCTCCTGCAGGAAGCT116 1248
11315631691171069897008CCCTCGAGGAACCCTGCGCA 231249
11315911777179671657184TGCCTTGCAGGGTGAGCCGG191250
11316191806182571947213GTCACCACAGCCCGATCCCC371251
11316471853187272417260CAGGCCAGGTAGTAGGCCAC481252
11316751893191272817300TGAGTCCCTGAGCAATCAGG19150
11317031932195173207339AGCCACTCTCTCACTGCGGA241253
11317311985200473737392CGCGGAGCTGGCCGCACTGG301254
11317592020203974087427TCAAAGCACTTTATTGAGTT111255
1131787N/AN/A133152CCCCCCAGAACAATCCTGGG801256
1131815N/AN/A217236GGCCTCACCTTTCCACATAG661257
1131843N/AN/A320339CCCCCGTTGTCTTCTTAAGG471258
1131871N/AN/A410429CCTGCCACCGATCTGTTGCT124 1259
1131899N/AN/A541560TTCCCGGGAGGAGGAGCCAG461260
1131927N/AN/A645664GATCACTCTAGTGCCCATGG481261
1131955N/AN/A763782TGGCAGGAGCCCAGGTGTGA661262
1131983N/AN/A901920GCATTCAGATGCCAGAGACA771263
1132011N/AN/A10151034AAGAGGTTTACTGTTATCAA551264
1132039N/AN/A11141133AAAGGTAGTTTCATAATAAA441265
1132067N/AN/A15301549GGCCCTGCTATGTGCCACAC931266
1132095N/AN/A16401659AGAGGAGGCTGAGGGAGTCC521267
1132123N/AN/A20752094ACCTTTAAGATGCAAATGGG511268
1132151N/AN/A21752194CTGCTCAATAAGCTTTTGCC541269
1132179N/AN/A22922311TTATAGAACATAACCATCGC681270
1132207N/AN/A24262445CATATACTAAATAAAATGTC991271
1132235N/AN/A25452564TGAAGAGCTGTGTAGTTCCT581272
1132263N/AN/A26672686GCTGCTTGTTTCAGCTCTCC551273
1132291N/AN/A27802799TTGTAACTCCCAAGTCAATA781274
1132319N/AN/A28932912CTCTGATCTGAGCCTTGGTT951275
1132347N/AN/A29833002GTAAGTCTTCAGTCCCAAGG861276
1132375N/AN/A33913410GTGCATTGAAAACACTTTCT411277
1132403N/AN/A34783497CTCTGAGGACTTCCCCTGTA166 1278
1132431N/AN/A36763695AAGCAGAGTTCCTTGGACAG571279
1132459N/AN/A38423861CAGAGGCTGTGTGTAGCACC761280
1132487N/AN/A39663985TCCCTCTGGACTTCCAAAGG471281
1132515N/AN/A40544073GAACCTACTTGCCTTGTGAC591282
1132543N/AN/A42544273GTCCTCCACATCTCCTCACC471283
1132571N/AN/A43554374TAGTGGTCTCAGGAGAGTCT921284
1132599N/AN/A45874606CTCCTTCCTGGCACACCACC381285
1132627N/AN/A48034822GCAAGCCCGTCCCACCTGGG471286
1132655N/AN/A50735092CCCACGCGGCGCACCGGCAG481287
1132683N/AN/A54395458GAGCCCGCGGCCGGCTGGCC681288
1132711N/AN/A58625881CCAATCCCGTGTTCCAGCTT371289
1132739N/AN/A63246343CCCCTAGCAGTTGTGCCTAC138 1290
1132767N/AN/A64156434GCCACCCATTCTGTAGGCAC591291
1132795N/AN/A65366555CCAAGAGCAAGTTCGATTCT501292
1132823N/AN/A66616680GCGGAGCGGAAACAGAAACC881293
1132851N/AN/A67676786TCATGCCCTTCCTCTCTCGC391294
1132879N/AN/A70257044CCGGGCTAAGAGCTCACCTG 591295
TABLE 21
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation,
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopFXIISEQ ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113075215341534GTCCAGCTGCCTATCCAGGA491296
113078057765776GAACCCCAGGAGCAGCAGAG721297
1130808103122N/AN/ACTTCCCAAGGTGGAATCGAA621298
1130836154173N/AN/ACAGTGAGAACGACTGTGTGC411299
113086420822735593578TGTGGTACAGCTGCCGGTGG421300
113087121623535673586GGTACATTTGTGGTACAGCT21183
1130893254273N/AN/AGTAGCACACCAGGGCTGAGG541301
113092131333238203839TCACTTTCTTGGGCTCCAAA411302
113094937139041794198GGCATGTTCACACAGGTCCC421303
1130977428447N/AN/ATCTTTCTGGCAGTGGTTTCC481304
113100547149044164435ATTCTTGTGGAAAAACCGGA391305
113103351153044564475ATCTGGCCACAGCTGCTTGC531306
113106155157044964515GCCAGCCGCTGGCAGTGGGC581307
113108958860746724691CCCATGGAGGCACGGGTTGG401308
113111762764647114730GTGGCACAGGCGGTGGCCCT711309
113114569070949194938GCCATCATAGCAGCTTGCCT361310
113117374576449744993GACAGGGCGCACCCGAGAGC521311
113120179981850285047TCCGCGCTTGCTCGGCAGTC741312
113122988290151965215CCGGTCGCGGTTCAGCACGA461313
113125792093952345253GTCTGGCACTGTGCCAGGTC741314
11312851011103053255344GGGCTGAGGCTTCGGCGGTG311315
11313131092111155115530GTTCCTGGTCAGGGAAGGCG521316
11313411134115355535572AGACAGACTCTTGCGGAGCC371317
11313691207122656265645CCCAGTACAGCGCGGCGATG321318
11313971281130057005719CCGGTCCTGCAGGCAGTGAG591319
11314251345136460056024ACGGCTCACAGCTGTGGTTA491320
11314531437145661806199CTCCTGAAGGCGCAACAGAG661321
11314811496151562396258CTTGGCAGGCACACCGGCTG241322
113150915641583N/AN/ACCCCCTCGAACTGGTGGCCC761323
11315371603162269016920GTACCTGCGCCTCCTGCAGG126 1324
11315651696171569947013TGCCGCCCTCGAGGAACCCT  81325
11315931780179971687187TGATGCCTTGCAGGGTGAGC171326
11316211808182771967215CGGTCACCACAGCCCGATCC351327
11316491856187572447263ATCCAGGCCAGGTAGTAGGC701328
11316771895191472837302GATGAGTCCCTGAGCAATCA351329
11317051935195473237342CCCAGCCACTCTCTCACTGC371330
11317331989200873777396CTGGCGCGGAGCTGGCCGCA491331
11317612023204274117430TTTTCAAAGCACTTTATTGA281332
1131789N/AN/A139158TAGCGACCCCCCAGAACAAT101 1333
1131817N/AN/A223242CGGGCTGGCCTCACCTTTCC741334
1131845N/AN/A326345TACCTCCCCCCGTTGTCTTC105 1335
1131873N/AN/A416435TCATAGCCTGCCACCGATCT771336
1131901N/AN/A560579ACACATCCCCACCCAAGGGT611337
1131929N/AN/A651670GCTCACGATCACTCTAGTGC441338
1131957N/AN/A770789GGAAGGCTGGCAGGAGCCCA811339
1131985N/AN/A910929GCTTCAGAGGCATTCAGATG841340
1132013N/AN/A10211040AACCCTAAGAGGTTTACTGT105 1341
1132041N/AN/A11201139CATCTAAAAGGTAGTTTCAT901342
1132069N/AN/A15361555TTCACAGGCCCTGCTATGTG101 1343
1132097N/AN/A16671686GGAGAAACTTTTGGGTGTGG861344
1132125N/AN/A20812100AGATGGACCTTTAAGATGCA791345
1132153N/AN/A21812200AAGTACCTGCTCAATAAGCT611346
1132181N/AN/A22992318TGTGATTTTATAGAACATAA711347
1132209N/AN/A24372456AATCAGCAACACATATACTA731348
1132237N/AN/A25512570TCCTGCTGAAGAGCTGTGTA661349
1132265N/AN/A26732692GCTGCTGCTGCTTGTTTCAG421350
1132293N/AN/A27862805TTTTATTTGTAACTCCCAAG100 1351
1132321N/AN/A28992918TAACCACTCTGATCTGAGCC801352
1132349N/AN/A29893008CCTTGGGTAAGTCTTCAGTC107 1353
1132377N/AN/A33973416GTCGCTGTGCATTGAAAACA981354
1132405N/AN/A34843503CACACTCTCTGAGGACTTCC831355
1132433N/AN/A36823701CTCTCCAAGCAGAGTTCCTT891356
1132461N/AN/A38483867CCACCCCAGAGGCTGTGTGT901357
1132489N/AN/A39723991GAACTCTCCCTCTGGACTTC611358
1132517N/AN/A40604079CTTCTTGAACCTACTTGCCT661359
1132545N/AN/A42604279GCCCAGGTCCTCCACATCTC601360
1132573N/AN/A43614380GAGGGATAGTGGTCTCAGGA761361
1132601N/AN/A45934612AGAGCTCTCCTTCCTGGCAC601362
1132629N/AN/A48094828TTCCTGGCAAGCCCGTCCCA501363
1132657N/AN/A50795098CCCAGCCCCACGCGGCGCAC105 1364
1132685N/AN/A54455464GACGGAGAGCCCGCGGCCGG109 1365
1132713N/AN/A58685887CGAACCCCAATCCCGTGTTC811366
1132741N/AN/A63306349CCCCTGCCCCTAGCAGTTGT111 1367
1132769N/AN/A64366455CTCACAACCCATCAGGTCAG971368
1132797N/AN/A65426561AGGGAACCAAGAGCAAGTTC261369
1132825N/AN/A66676686GAATGGGCGGAGCGGAAACA731370
1132853N/AN/A67736792ACCCACTCATGCCCTTCCTC421371
1132881N/AN/A70317050CGCCAACCGGGCTAAGAGCT 821372
TABLE 22
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation,
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopFXIISEQ ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113075316351635GGTCCAGCTGCCTATCCAGG371373
113078160796079CAGGAACCCCAGGAGCAGCA651374
1130809104123N/AN/AGCTTCCCAAGGTGGAATCGA671375
1130837156175N/AN/AGACAGTGAGAACGACTGTGT431376
113086521022935613580TTTGTGGTACAGCTGCCGGT521377
113087121623535673586GGTACATTTGTGGTACAGCT20183
1130894257276N/AN/AGTGGTAGCACACCAGGGCTG191378
113092231433338213840TTCACTTTCTTGGGCTCCAA361379
113095037239141804199TGGCATGTTCACACAGGTCC421380
1130978429448N/AN/ACTCTTTCTGGCAGTGGTTTC451381
113100647249144174436CATTCTTGTGGAAAAACCGG221382
113103451253144574476CATCTGGCCACAGCTGCTTG421383
113106255257144974516GGCCAGCCGCTGGCAGTGGG871384
113109058960846734692CCCCATGGAGGCACGGGTTG361385
113111862864747124731AGTGGCACAGGCGGTGGCCC321386
113114669171049204939GGCCATCATAGCAGCTTGCC271387
113117474776649764995CTGACAGGGCGCACCCGAGA491388
113120280081950295048TTCCGCGCTTGCTCGGCAGT351389
113123088390251975216GCCGGTCGCGGTTCAGCACG421390
113125892194052355254GGTCTGGCACTGTGCCAGGT341391
11312861012103153265345TGGGCTGAGGCTTCGGCGGT451392
11313141093111255125531CGTTCCTGGTCAGGGAAGGC151393
11313421135115455545573AAGACAGACTCTTGCGGAGC291394
11313701209122856285647GCCCCAGTACAGCGCGGCGA531395
11313981282130157015720GCCGGTCCTGCAGGCAGTGA481396
11314261346136560066025CACGGCTCACAGCTGTGGTT281397
11314541439145861826201TCCTCCTGAAGGCGCAACAG331398
11314821497151662406259GCTTGGCAGGCACACCGGCT411399
113151015651584N/AN/AGCCCCCTCGAACTGGTGGCC491400
11315381604162369026921GGTACCTGCGCCTCCTGCAG154 1401
11315661699171869977016CGGTGCCGCCCTCGAGGAAC  61402
11315941781180071697188ATGATGCCTTGCAGGGTGAG291403
11316221810182971987217TGCGGTCACCACAGCCCGAT371404
11316501857187672457264GATCCAGGCCAGGTAGTAGG291405
11316781896191572847303AGATGAGTCCCTGAGCAATC321406
11317061938195773267345TGCCCCAGCCACTCTCTCAC251407
11317341990200973787397CCTGGCGCGGAGCTGGCCGC441408
11317622024204374127431ATTTTCAAAGCACTTTATTG321409
1131790N/AN/A142161TGATAGCGACCCCCCAGAAC801410
1131818N/AN/A229248GCCTTCCGGGCTGGCCTCAC911411
1131846N/AN/A329348TTCTACCTCCCCCCGTTGTC106 1412
1131874N/AN/A419438AAGTCATAGCCTGCCACCGA105 1413
1131902N/AN/A563582CATACACATCCCCACCCAAG851414
1131930N/AN/A654673ACAGCTCACGATCACTCTAG671415
1131958N/AN/A773792TGAGGAAGGCTGGCAGGAGC761416
1131986N/AN/A913932TGGGCTTCAGAGGCATTCAG501417
1132014N/AN/A10241043AACAACCCTAAGAGGTTTAC621418
1132042N/AN/A11231142CTTCATCTAAAAGGTAGTTT481419
1132070N/AN/A15391558TGGTTCACAGGCCCTGCTAT661420
1132098N/AN/A16701689AGAGGAGAAACTTTTGGGTG681421
1132126N/AN/A20842103CTGAGATGGACCTTTAAGAT541422
1132154N/AN/A21882207TGGCACAAAGTACCTGCTCA531423
1132182N/AN/A23022321CACTGTGATTTTATAGAACA651424
1132210N/AN/A24402459ATGAATCAGCAACACATATA581425
1132238N/AN/A25542573GCCTCCTGCTGAAGAGCTGT611426
1132266N/AN/A26762695CACGCTGCTGCTGCTTGTTT751427
1132294N/AN/A27892808GAATTTTATTTGTAACTCCC841428
1132322N/AN/A29022921TGTTAACCACTCTGATCTGA591429
1132350N/AN/A29923011TGACCTTGGGTAAGTCTTCA931430
1132378N/AN/A34003419AAGGTCGCTGTGCATTGAAA841431
1132406N/AN/A34873506CAACACACTCTCTGAGGACT551432
1132434N/AN/A36853704CCTCTCTCCAAGCAGAGTTC491433
1132462N/AN/A38513870AGGCCACCCCAGAGGCTGTG381434
1132490N/AN/A39753994CCAGAACTCTCCCTCTGGAC741435
1132518N/AN/A40634082GCCCTTCTTGAACCTACTTG731436
1132546N/AN/A42634282CCCGCCCAGGTCCTCCACAT591437
1132574N/AN/A43644383AAAGAGGGATAGTGGTCTCA741438
1132602N/AN/A45964615CAGAGAGCTCTCCTTCCTGG811439
1132630N/AN/A48124831TCCTTCCTGGCAAGCCCGTC401440
1132658N/AN/A50825101TCACCCAGCCCCACGCGGCG441441
1132686N/AN/A54485467GAGGACGGAGAGCCCGCGGC751442
1132714N/AN/A58715890TCCCGAACCCCAATCCCGTG831443
1132742N/AN/A63336352CTACCCCTGCCCCTAGCAGT701444
1132770N/AN/A64396458ATTCTCACAACCCATCAGGT103 1445
1132798N/AN/A65486567GCCCAGAGGGAACCAAGAGC851446
1132826N/AN/A66706689TTTGAATGGGCGGAGCGGAA861447
1132854N/AN/A67766795TAAACCCACTCATGCCCTTC871448
1132882N/AN/A70577076TTGTGCCTGACGGCCTCGGG 841449
TABLE 23
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation,
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopFXIISEQ ID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113075114331433TCCAGCTGCCTATCCAGGAG651450
113077951705170CAGGAGCAGCAGAGCCCTCA391451
113080799118N/AN/ACCAAGGTGGAATCGAAAGTG371452
1130835153172N/AN/AAGTGAGAACGACTGTGTGCT291453
113086320722635583577GTGGTACAGCTGCCGGTGGT231454
113087121623535673586GGTACATTTGTGGTACAGCT 8183
113089224226135933612GGCTGAGGGCCTGGCCGGCC541455
113092031233138193838CACTTTCTTGGGCTCCAAAC171456
113094837038941784197GCATGTTCACACAGGTCCCT361457
113097642744642354254CTTTCTGGCAGTGGTTTCCA251458
113100447048944154434TTCTTGTGGAAAAACCGGAG281459
113103251052944554474TCTGGCCACAGCTGCTTGCT261460
113106055056944954514CCAGCCGCTGGCAGTGGGCA531461
113108858660546704689CATGGAGGCACGGGTTGGTG891462
113111662564447094728GGCACAGGCGGTGGCCCTCC471463
113114468870749174936CATCATAGCAGCTTGCCTTG401464
113117274476349734992ACAGGGCGCACCCGAGAGCG501465
113120079881750275046CCGCGCTTGCTCGGCAGTCA311466
113122887689551905209GCGGTTCAGCACGAAGCACC471467
113125691993852335252TCTGGCACTGTGCCAGGTCG431468
11312841010102953245343GGCTGAGGCTTCGGCGGTGC271469
11313121091111055105529TTCCTGGTCAGGGAAGGCGG351470
11313401133115255525571GACAGACTCTTGCGGAGCCG191471
11313681206122556255644CCAGTACAGCGCGGCGATGT171472
11313961280129956995718CGGTCCTGCAGGCAGTGAGC261473
11314241344136360046023CGGCTCACAGCTGTGGTTAC191474
11314521436145561796198TCCTGAAGGCGCAACAGAGC391475
11314801494151362376256TGGCAGGCACACCGGCTGAA221476
113150815631582N/AN/ACCCCTCGAACTGGTGGCCCC132 1477
11315361601162068996918ACCTGCGCCTCCTGCAGGAA108 1478
11315641694171369927011CCGCCCTCGAGGAACCCTGC 101479
11315921778179771667185ATGCCTTGCAGGGTGAGCCG241480
11316201807182671957214GGTCACCACAGCCCGATCCC231481
11316481855187472437262TCCAGGCCAGGTAGTAGGCC811482
11316761894191372827301ATGAGTCCCTGAGCAATCAG441483
11317041933195273217340CAGCCACTCTCTCACTGCGG111484
11317321986200573747393GCGCGGAGCTGGCCGCACTG241485
11317602021204074097428TTCAAAGCACTTTATTGAGT 61486
1131788N/AN/A136155CGACCCCCCAGAACAATCCT541487
1131816N/AN/A220239GCTGGCCTCACCTTTCCACA691488
1131844N/AN/A323342CTCCCCCCGTTGTCTTCTTA871489
1131872N/AN/A413432TAGCCTGCCACCGATCTGTT591490
1131900N/AN/A557576CATCCCCACCCAAGGGTTCC801491
1131928N/AN/A648667CACGATCACTCTAGTGCCCA671492
1131956N/AN/A767786AGGCTGGCAGGAGCCCAGGT611493
1131984N/AN/A904923GAGGCATTCAGATGCCAGAG101 1494
1132012N/AN/A10181037CCTAAGAGGTTTACTGTTAT461495
1132040N/AN/A11171136CTAAAAGGTAGTTTCATAAT701496
1132068N/AN/A15331552ACAGGCCCTGCTATGTGCCA671497
1132096N/AN/A16471666GGTGAAGAGAGGAGGCTGAG681498
1132124N/AN/A20782097TGGACCTTTAAGATGCAAAT531499
1132152N/AN/A21782197TACCTGCTCAATAAGCTTTT541500
1132180N/AN/A22952314ATTTTATAGAACATAACCAT125 1501
1132208N/AN/A24302449AACACATATACTAAATAAAA881502
1132236N/AN/A25482567TGCTGAAGAGCTGTGTAGTT771503
1132264N/AN/A26702689GCTGCTGCTTGTTTCAGCTC721504
1132292N/AN/A27832802TATTTGTAACTCCCAAGTCA661505
1132320N/AN/A28962915CCACTCTGATCTGAGCCTTG871506
1132348N/AN/A29863005TGGGTAAGTCTTCAGTCCCA641507
1132376N/AN/A33943413GCTGTGCATTGAAAACACTT321508
1132404N/AN/A34813500ACTCTCTGAGGACTTCCCCT481509
1132432N/AN/A36793698TCCAAGCAGAGTTCCTTGGA102 1510
1132460N/AN/A38453864CCCCAGAGGCTGTGTGTAGC801511
1132488N/AN/A39693988CTCTCCCTCTGGACTTCCAA521512
1132516N/AN/A40574076CTTGAACCTACTTGCCTTGT531513
1132544N/AN/A42574276CAGGTCCTCCACATCTCCTC571514
1132572N/AN/A43584377GGATAGTGGTCTCAGGAGAG821515
1132600N/AN/A45904609GCTCTCCTTCCTGGCACACC731516
1132628N/AN/A48064825CTGGCAAGCCCGTCCCACCT521517
1132656N/AN/A50765095AGCCCCACGCGGCGCACCGG601518
1132684N/AN/A54425461GGAGAGCCCGCGGCCGGCTG721519
1132712N/AN/A58655884ACCCCAATCCCGTGTTCCAG641520
1132740N/AN/A63276346CTGCCCCTAGCAGTTGTGCC931521
1132768N/AN/A64336452ACAACCCATCAGGTCAGCGC109 1522
1132796N/AN/A65396558GAACCAAGAGCAAGTTCGAT671523
1132824N/AN/A66646683TGGGCGGAGCGGAAACAGAA461524
1132852N/AN/A67706789CACTCATGCCCTTCCTCTCT391525
1132880N/AN/A70287047CAACCGGGCTAAGAGCTCAC 561526
TABLE 24
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation,
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113075418371837TTGGTCCAGCTGCCTATCCA281527
113078265846584ACCAGCAGGAACCCCAGGAG941528
1130810106125473492GGGCTTCCCAAGGTGGAATC191529
1130838157176N/AN/ATGACAGTGAGAACGACTGTG331530
113086621123035623581ATTTGTGGTACAGCTGCCGG231531
113087121623535673586GGTACATTTGTGGTACAGCT11183
1130895258277N/AN/AGGTGGTAGCACACCAGGGCT481532
113092331633538233842CTTTCACTTTCTTGGGCTCC191533
113095137439341824201CTTGGCATGTTCACACAGGT261534
1130979430449N/AN/ATCTCTTTCTGGCAGTGGTTT171535
113100747349244184437TCATTCTTGTGGAAAAACCG181536
113103551353244584477GCATCTGGCCACAGCTGCTT381537
113106355357244984517TGGCCAGCCGCTGGCAGTGG671538
113109159060946744693CCCCCATGGAGGCACGGGTT42 208
113111963064947144733GCAGTGGCACAGGCGGTGGC301539
113114769371249224941GCGGCCATCATAGCAGCTTG461540
113117574876749774996GCTGACAGGGCGCACCCGAG321541
113120380182050305049GTTCCGCGCTTGCTCGGCAG301542
113123188490351985217AGCCGGTCGCGGTTCAGCAC251543
113125992294152365255GGGTCTGGCACTGTGCCAGG221544
11312871013103253275346GTGGGCTGAGGCTTCGGCGG491545
11313151094111355135532CCGTTCCTGGTCAGGGAAGG461546
11313431136115555555574GAAGACAGACTCTTGCGGAG381547
11313711210122956295648GGCCCCAGTACAGCGCGGCG541548
113139912841303N/AN/AGGGCCGGTCCTGCAGGCAGT641549
11314271347136660076026GCACGGCTCACAGCTGTGGT501550
11314551440145961836202ATCCTCCTGAAGGCGCAACA291551
11314831499151862426261CCGCTTGGCAGGCACACCGG291552
113151115661585N/AN/ACGCCCCCTCGAACTGGTGGC126 1553
11315391605162469036922CGGTACCTGCGCCTCCTGCA791554
11315671700171969987017TCGGTGCCGCCCTCGAGGAA  51555
11315951782180171707189GATGATGCCTTGCAGGGTGA151556
11316231811183071997218TTGCGGTCACCACAGCCCGA321557
11316511858187772467265GGATCCAGGCCAGGTAGTAG641558
11316791897191672857304AAGATGAGTCCCTGAGCAAT301559
11317071939195873277346ATGCCCCAGCCACTCTCTCA241560
11317351991201073797398TCCTGGCGCGGAGCTGGCCG251561
11317632026204574147433GCATTTTCAAAGCACTTTAT 91562
1131791N/AN/A145164CTGTGATAGCGACCCCCCAG571563
1131819N/AN/A241260TCCTCTGCCTGGGCCTTCCG831564
1131847N/AN/A332351CCTTTCTACCTCCCCCCGTT781565
1131875N/AN/A422441TATAAGTCATAGCCTGCCAC611566
1131903N/AN/A566585CACCATACACATCCCCACCC741567
1131931N/AN/A657676CACACAGCTCACGATCACTC901568
1131959N/AN/A776795AACTGAGGAAGGCTGGCAGG591569
1131987N/AN/A919938TAAAGCTGGGCTTCAGAGGC731570
1132015N/AN/A10271046CTCAACAACCCTAAGAGGTT122 1571
1132043N/AN/A11261145ACCCTTCATCTAAAAGGTAG421572
1132071N/AN/A15421561ATCTGGTTCACAGGCCCTGC441573
1132099N/AN/A16731692GAGAGAGGAGAAACTTTTGG511574
1132127N/AN/A20872106GATCTGAGATGGACCTTTAA681575
1132155N/AN/A21912210GTCTGGCACAAAGTACCTGC661576
1132183N/AN/A23082327AATGTTCACTGTGATTTTAT861577
1132211N/AN/A24432462TTGATGAATCAGCAACACAT861578
1132239N/AN/A25572576TGAGCCTCCTGCTGAAGAGC641579
1132267N/AN/A26792698CGTCACGCTGCTGCTGCTTG921580
1132295N/AN/A27922811GCTGAATTTTATTTGTAACT101 1581
1132323N/AN/A29052924CACTGTTAACCACTCTGATC491582
1132351N/AN/A30093028ACAACCTGCTAGCTGTGTGA651583
1132379N/AN/A34033422AAAAAGGTCGCTGTGCATTG551584
1132407N/AN/A34903509GGACAACACACTCTCTGAGG541585
1132435N/AN/A36883707TCCCCTCTCTCCAAGCAGAG531586
1132463N/AN/A38553874CCCCAGGCCACCCCAGAGGC671587
1132491N/AN/A39783997TTCCCAGAACTCTCCCTCTG591588
1132519N/AN/A40664085AAGGCCCTTCTTGAACCTAC501589
1132547N/AN/A42664285CACCCCGCCCAGGTCCTCCA991590
1132575N/AN/A43874406GCTCAAAGCACTTCTCTGGG251591
1132603N/AN/A45994618CCCCAGAGAGCTCTCCTTCC761592
1132631N/AN/A48164835CTCCTCCTTCCTGGCAAGCC431593
1132659N/AN/A50855104GGGTCACCCAGCCCCACGCG651594
1132687N/AN/A54515470GCTGAGGACGGAGAGCCCGC881595
1132715N/AN/A58745893TGCTCCCGAACCCCAATCCC431596
1132743N/AN/A63366355CCCCTACCCCTGCCCCTAGC651597
1132771N/AN/A64426461CACATTCTCACAACCCATCA721598
1132799N/AN/A65666585TGGCCTTTGCAGCCCGGCGC841599
1132827N/AN/A66736692GGATTTGAATGGGCGGAGCG491600
1132855N/AN/A67796798TTGTAAACCCACTCATGCCC521601
1132883N/AN/A70607079GATTTGTGCCTGACGGCCTC 421602
TABLE 25
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation,
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
1122SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113078366856685CACCAGCAGGAACCCCAGGA571603
1130811125144492511TTGTACTTATGCTCCTTGGG301604
1130839158177N/AN/AGTGACAGTGAGAACGACTGT141605
113086721223135633582CATTTGTGGTACAGCTGCCG221606
113087121623535673586GGTACATTTGTGGTACAGCT17 183
113089627829737853804TGGTCCTGATCAAAGTTGGG441607
1130924317336N/AN/ATCTTTCACTTTCTTGGGCTC301608
113095237539441834202GCTTGGCATGTTCACACAGG151609
1130980431450N/AN/ATTCTCTTTCTGGCAGTGGTT441610
113100847449344194438CTCATTCTTGTGGAAAAACC251611
113103651453344594478GGCATCTGGCCACAGCTGCT201612
113106455457344994518CTGGCCAGCCGCTGGCAGTG102 1613
113109259161046754694ACCCCCATGGAGGCACGGGT451614
113112063165047154734GGCAGTGGCACAGGCGGTGG201615
113114869671549254944CCCGCGGCCATCATAGCAGC571616
113117674976849784997GGCTGACAGGGCGCACCCGA311617
113120480282150315050AGTTCCGCGCTTGCTCGGCA131618
113123288690552005219TCAGCCGGTCGCGGTTCAGC391619
113126097499352885307AGTGGGACATGAAGCCTAGG341620
113128810601079N/AN/ATCGCCGGCAAGGCTCCCGGG681621
11313161095111455145533GCCGTTCCTGGTCAGGGAAG271622
11313441138115755575576TCGAAGACAGACTCTTGCGG151623
11313721212123156315650GTGGCCCCAGTACAGCGCGG321624
113140012851304N/AN/ACGGGCCGGTCCTGCAGGCAG341625
11314281351137060116030TCTGGCACGGCTCACAGCTG171626
11314561441146061846203CATCCTCCTGAAGGCGCAAC511627
11314841500151962436262GCCGCTTGGCAGGCACACCG171628
113151215671586N/AN/ACCGCCCCCTCGAACTGGTGG125 1629
11315401609162869076926GGAACGGTACCTGCGCCTCC621630
11315681701172069997018ATCGGTGCCGCCCTCGAGGA 431631
11315961783180271717190TGATGATGCCTTGCAGGGTG211632
11316241812183172007219GTTGCGGTCACCACAGCCCG201633
11316521860187972487267CCGGATCCAGGCCAGGTAGT301634
11316801898191772867305AAAGATGAGTCCCTGAGCAA201635
11317081940195973287347CATGCCCCAGCCACTCTCTC251636
11317361993201273817400CATCCTGGCGCGGAGCTGGC161637
11317642027204674157434AGCATTTTCAAAGCACTTTA 9  97
1131792N/AN/A148167TGGCTGTGATAGCGACCCCC501638
1131820N/AN/A244263GTCTCCTCTGCCTGGGCCTT611639
1131848N/AN/A335354AACCCTTTCTACCTCCCCCC761640
1131876N/AN/A425444GACTATAAGTCATAGCCTGC145 1641
1131904N/AN/A569588CTGCACCATACACATCCCCA371642
1131932N/AN/A660679GATCACACAGCTCACGATCA541643
1131960N/AN/A779798GGAAACTGAGGAAGGCTGGC851644
1131988N/AN/A922941TGATAAAGCTGGGCTTCAGA691645
1132016N/AN/A10311050CCTTCTCAACAACCCTAAGA591646
1132044N/AN/A11291148GGTACCCTTCATCTAAAAGG561647
1132072N/AN/A15451564TCCATCTGGTTCACAGGCCC661648
1132100N/AN/A16761695CAAGAGAGAGGAGAAACTTT108 1649
1132128N/AN/A20902109ATGGATCTGAGATGGACCTT341650
1132156N/AN/A21942213AGTGTCTGGCACAAAGTACC281651
1132184N/AN/A23112330TTCAATGTTCACTGTGATTT521652
1132212N/AN/A24462465GCATTGATGAATCAGCAACA551653
1132240N/AN/A25602579CTCTGAGCCTCCTGCTGAAG331654
1132268N/AN/A26972716AGTTAAGGTTCAACAAGGCG361655
1132296N/AN/A28022821GTGCCTACTTGCTGAATTTT681656
1132324N/AN/A29082927AGTCACTGTTAACCACTCTG411657
1132352N/AN/A30123031TCCACAACCTGCTAGCTGTG291658
1132380N/AN/A34063425CTCAAAAAGGTCGCTGTGCA361659
1132408N/AN/A34933512CAGGGACAACACACTCTCTG861660
1132436N/AN/A36913710CAGTCCCCTCTCTCCAAGCA551661
1132464N/AN/A38593878AGAGCCCCAGGCCACCCCAG391662
1132492N/AN/A39814000TCCTTCCCAGAACTCTCCCT531663
1132520N/AN/A40694088GCCAAGGCCCTTCTTGAACC251664
1132548N/AN/A42694288CAGCACCCCGCCCAGGTCCT731665
1132576N/AN/A45054524CCCTGGCTGGCCAGCCGCTG461666
1132604N/AN/A46024621CCCCCCCAGAGAGCTCTCCT120 1667
1132632N/AN/A48194838TCCCTCCTCCTTCCTGGCAA301668
1132660N/AN/A51125131CCGGGAGCCCGGAGCCCTGG681669
1132688N/AN/A54715490AAGGCTGTGGAGGAGCAGGG691670
1132716N/AN/A58775896CCCTGCTCCCGAACCCCAAT691671
1132744N/AN/A63436362GTCTCCTCCCCTACCCCTGC631672
1132772N/AN/A64456464CTACACATTCTCACAACCCA571673
1132800N/AN/A65696588AGTTGGCCTTTGCAGCCCGG341674
1132828N/AN/A66766695CCAGGATTTGAATGGGCGGA651675
1132856N/AN/A67826801CGCTTGTAAACCCACTCATG511676
1132884N/AN/A70637082TGAGATTTGTGCCTGACGGC1261677
TABLE 26
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation,
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
1122SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113075721402140CCGTTGGTCCAGCTGCCTAT421678
113078569886988GCTCACCAGCAGGAACCCCA251679
1130813127146494513CTTTGTACTTATGCTCCTTG551680
1130841161180N/AN/ACCGGTGACAGTGAGAACGAC111681
113086921423335653584TACATTTGTGGTACAGCTGC131682
113087121623535673586GGTACATTTGTGGTACAGCT10183
113089828130037883807CGCTGGTCCTGATCAAAGTT141683
1130926320339N/AN/ATGGTCTTTCACTTTCTTGGG231684
113095437739641854204CCGCTTGGCATGTTCACACA151685
1130982435454N/AN/AGCACTTCTCTTTCTGGCAGT211686
113101047649544214440ATCTCATTCTTGTGGAAAAA291687
113103851753644624481ACTGGCATCTGGCCACAGCT361688
113106655657545014520GGCTGGCCAGCCGCTGGCAG511689
113109459461346784697GCGACCCCCATGGAGGCACG261690
113112263565447194738ACCGGGCAGTGGCACAGGCG501691
113115069871749274946AGCCCGCGGCCATCATAGCA561692
113117875177049804999ACGGCTGACAGGGCGCACCC29  52
113120680582450345053CCCAGTTCCGCGCTTGCTCG281693
113123488990852035222AGCTCAGCCGGTCGCGGTTC251694
113126297699552905309TGAGTGGGACATGAAGCCTA251695
113129010621081N/AN/ACTTCGCCGGCAAGGCTCCCG361696
11313181104112355235542GCTCAGTGGGCCGTTCCTGG311697
11313461140115955595578CATCGAAGACAGACTCTTGC151698
11313741215123456345653ACTGTGGCCCCAGTACAGCG221699
113140212881307N/AN/AGTGCGGGCCGGTCCTGCAGG791700
11314301353137260136032CGTCTGGCACGGCTCACAGC221701
11314581443146261866205CGCATCCTCCTGAAGGCGCA111702
11314861520153962636282GTCTCGGAGGGTCGCGCGGC471703
113151415691588N/AN/ACTCCGCCCCCTCGAACTGGT611704
11315421612163169106929AGAGGAACGGTACCTGCGCC155 1705
11315701704172370027021CGCATCGGTGCCGCCCTCGA 201706
11315981785180471737192GCTGATGATGCCTTGCAGGG211707
11316261815183472037222CTTGTTGCGGTCACCACAGC531708
11316541862188172507269TCCCGGATCCAGGCCAGGTA601709
11316821905192472937312AGGAGGGAAAGATGAGTCCC171710
11317101942196173307349TCCATGCCCCAGCCACTCTC101711
11317381995201473837402GCCATCCTGGCGCGGAGCTG21 157
11317662029204874177436TCAGCATTTTCAAAGCACTT 91712
1131794N/AN/A154173GGCTCATGGCTGTGATAGCG361713
1131822N/AN/A250269TTGTCTGTCTCCTCTGCCTG791714
1131850N/AN/A341360GACCCAAACCCTTTCTACCT371715
1131878N/AN/A431450GGAACTGACTATAAGTCATA681716
1131906N/AN/A576595GCACACACTGCACCATACAC741717
1131934N/AN/A666685CTCAAGGATCACACAGCTCA551718
1131962N/AN/A835854GCATGAATGATGCCCATGAG851719
1131990N/AN/A928947CATAAGTGATAAAGCTGGGC421720
1132018N/AN/A10371056GGTTTCCCTTCTCAACAACC581721
1132046N/AN/A11351154ATGGCAGGTACCCTTCATCT851722
1132074N/AN/A15511570GTAAGGTCCATCTGGTTCAC611723
1132102N/AN/A16821701GTAAGGCAAGAGAGAGGAGA351724
1132130N/AN/A20962115ATGGAAATGGATCTGAGATG531725
1132158N/AN/A22042223AATGCTGAGCAGTGTCTGGC591726
1132186N/AN/A23172336TGCTAGTTCAATGTTCACTG311727
1132214N/AN/A24522471AGCTTAGCATTGATGAATCA491728
1132242N/AN/A25672586AAATGGCCTCTGAGCCTCCT671729
1132270N/AN/A27032722ATTCCCAGTTAAGGTTCAAC451730
1132298N/AN/A28082827GAGAATGTGCCTACTTGCTG391731
1132326N/AN/A29142933TGTTGAAGTCACTGTTAACC911732
1132354N/AN/A30183037CCTGACTCCACAACCTGCTA361733
1132382N/AN/A34123431CAGACCCTCAAAAAGGTCGC291734
1132410N/AN/A35023521TGAGAACTGCAGGGACAACA761735
1132438N/AN/A36973716CTATCACAGTCCCCTCTCTC641736
1132466N/AN/A38653884GAGGAGAGAGCCCCAGGCCA511737
1132494N/AN/A39874006GACCACTCCTTCCCAGAACT561738
1132522N/AN/A40934112GGGAGCTGAGTCACACAGCT671739
1132550N/AN/A42834302TTGCCCCTGTCCCCCAGCAC711740
1132578N/AN/A45114530TGCTCACCCTGGCTGGCCAG481741
1132606N/AN/A46084627TAAAGACCCCCCCAGAGAGC301742
1132634N/AN/A48264845CGCACTCTCCCTCCTCCTTC511743
1132662N/AN/A51465165TCCTGTAGCCACACGACGGG521744
1132690N/AN/A54805499TTCGCCGGCAAGGCTGTGGA641745
1132718N/AN/A58835902GAAGCCCCCTGCTCCCGAAC261746
1132746N/AN/A63496368TCAAAGGTCTCCTCCCCTAC451747
1132774N/AN/A64516470ATTCACCTACACATTCTCAC821748
1132802N/AN/A65756594CGTCCTAGTTGGCCTTTGCA861749
1132830N/AN/A66856704AGAGAAAAGCCAGGATTTGA931750
1132858N/AN/A68026821ATGGACAAAGCTGCTCCAGG301751
1132886N/AN/A70697088TGGACCTGAGATTTGTGCCT 771752
TABLE 27
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed
PO/PS internucleoside linkages (Huh7, electroporation
5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
1122SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5' to 3')(% UTC)NO
113078468876887CTCACCAGCAGGAACCCCAG106 1753
1130812126145493512TTTGTACTTATGCTCCTTGG181754
1130840160179N/AN/ACGGTGACAGTGAGAACGACT181755
113086821323235643583ACATTTGTGGTACAGCTGCC181756
113087121623535673586GGTACATTTGTGGTACAGCT16 183
113089728029937873806GCTGGTCCTGATCAAAGTTG221757
1130925319338N/AN/AGGTCTTTCACTTTCTTGGGC161758
113095337639541844203CGCTTGGCATGTTCACACAG401759
1130981434453N/AN/ACACTTCTCTTTCTGGCAGTG151760
113100947549444204439TCTCATTCTTGTGGAAAAAC181761
113103751653544614480CTGGCATCTGGCCACAGCTG251762
113106555557445004519GCTGGCCAGCCGCTGGCAGT131 1763
113109359261146764695GACCCCCATGGAGGCACGGG361764
113112163365247174736CGGGCAGTGGCACAGGCGGT201765
113114969771649264945GCCCGCGGCCATCATAGCAG351766
113117775076949794998CGGCTGACAGGGCGCACCCG261767
113120580482350335052CCAGTTCCGCGCTTGCTCGG261768
113123388890752025221GCTCAGCCGGTCGCGGTTCA211769
113126197599452895308GAGTGGGACATGAAGCCTAG241770
113128910611080N/AN/ATTCGCCGGCAAGGCTCCCGG401771
11313171102112155215540TCAGTGGGCCGTTCCTGGTC311772
11313451139115855585577ATCGAAGACAGACTCTTGCG191773
11313731213123256325651TGTGGCCCCAGTACAGCGCG431774
113140112861305N/AN/AGCGGGCCGGTCCTGCAGGCA281775
11314291352137160126031GTCTGGCACGGCTCACAGCT161776
11314571442146161856204GCATCCTCCTGAAGGCGCAA241777
11314851501152062446263CGCCGCTTGGCAGGCACACC451778
113151315681587N/AN/ATCCGCCCCCTCGAACTGGTG701779
11315411610162969086927AGGAACGGTACCTGCGCCTC661780
11315971784180371727191CTGATGATGCCTTGCAGGGT241781
11316251813183272017220TGTTGCGGTCACCACAGCCC151782
11316531861188072497268CCCGGATCCAGGCCAGGTAG401783
11316811901192072897308GGGAAAGATGAGTCCCTGAG19  92
11317091941196073297348CCATGCCCCAGCCACTCTCT181784
11317371994201373827401CCATCCTGGCGCGGAGCTGG171785
11317652028204774167435CAGCATTTTCAAAGCACTTT391786
1131793N/AN/A151170TCATGGCTGTGATAGCGACC801787
1131821N/AN/A247266TCTGTCTCCTCTGCCTGGGC911788
1131849N/AN/A338357CCAAACCCTTTCTACCTCCC103 1789
1131877N/AN/A428447ACTGACTATAAGTCATAGCC771790
1131905N/AN/A572591ACACTGCACCATACACATCC591791
1131933N/AN/A663682AAGGATCACACAGCTCACGA641792
1131961N/AN/A832851TGAATGATGCCCATGAGACG331793
1131989N/AN/A925944AAGTGATAAAGCTGGGCTTC611794
1132017N/AN/A10341053TTCCCTTCTCAACAACCCTA491795
1132045N/AN/A11321151GCAGGTACCCTTCATCTAAA441796
1132073N/AN/A15481567AGGTCCATCTGGTTCACAGG411797
1132101N/AN/A16791698AGGCAAGAGAGAGGAGAAAC371798
1132129N/AN/A20932112GAAATGGATCTGAGATGGAC651799
1132157N/AN/A22012220GCTGAGCAGTGTCTGGCACA351800
1132185N/AN/A23142333TAGTTCAATGTTCACTGTGA441801
1132213N/AN/A24492468TTAGCATTGATGAATCAGCA461802
1132241N/AN/A25642583TGGCCTCTGAGCCTCCTGCT601803
1132269N/AN/A27002719CCCAGTTAAGGTTCAACAAG621804
1132297N/AN/A28052824AATGTGCCTACTTGCTGAAT771805
1132325N/AN/A29112930TGAAGTCACTGTTAACCACT451806
1132353N/AN/A30153034GACTCCACAACCTGCTAGCT621807
1132381N/AN/A34093428ACCCTCAAAAAGGTCGCTGT581808
1132409N/AN/A34993518GAACTGCAGGGACAACACAC481809
1132437N/AN/A36943713TCACAGTCCCCTCTCTCCAA631810
1132465N/AN/A38623881GAGAGAGCCCCAGGCCACCC411811
1132493N/AN/A39844003CACTCCTTCCCAGAACTCTC521812
1132521N/AN/A40904109AGCTGAGTCACACAGCTGGG691813
1132549N/AN/A42724291CCCCAGCACCCCGCCCAGGT113 1814
1132577N/AN/A45084527TCACCCTGGCTGGCCAGCCG103 1815
1132605N/AN/A46054624AGACCCCCCCAGAGAGCTCT721816
1132633N/AN/A48234842ACTCTCCCTCCTCCTTCCTG421817
1132661N/AN/A51155134GCGCCGGGAGCCCGGAGCCC921818
1132689N/AN/A54745493GGCAAGGCTGTGGAGGAGCA821819
1132717N/AN/A58805899GCCCCCTGCTCCCGAACCCC651820
1132745N/AN/A63466365AAGGTCTCCTCCCCTACCCC681821
1132773N/AN/A64486467CACCTACACATTCTCACAAC661822
1132801N/AN/A65726591CCTAGTTGGCCTTTGCAGCC671823
1132829N/AN/A66796698AAGCCAGGATTTGAATGGGC501824
1132857N/AN/A67996818GACAAAGCTGCTCCAGGCGC741825
11315691703172270017020GCATCGGTGCCGCCCTCGAG  81826
1132885N/AN/A70667085ACCTGAGATTTGTGCCTGAC 721827
TABLE 28
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113075822412241TCCGTTGGTCCAGCTGCCTA701828
113078670897089AGCTCACCAGCAGGAACCCC551829
1130814128147495514GCTTTGTACTTATGCTCCTT301830
1130842162181N/AN/ACCCGGTGACAGTGAGAACGA431831
113087021523435663585GTACATTTGTGGTACAGCTG19182
113087121623535673586GGTACATTTGTGGTACAGCT10183
113089928230137893808TCGCTGGTCCTGATCAAAGT301832
1130927322341N/AN/AAGTGGTCTTTCACTTTCTTG411833
113095537839741864205GCCGCTTGGCATGTTCACAC461834
1130983436455N/AN/AAGCACTTCTCTTTCTGGCAG141835
113101147849744234442ATATCTCATTCTTGTGGAAA391836
113103952454344694488CCCTTGCACTGGCATCTGGC381837
113106755757645024521TGGCTGGCCAGCCGCTGGCA451838
113109559561446794698AGCGACCCCCATGGAGGCAC211839
113112363765647214740CCACCGGGCAGTGGCACAGG421840
113115169971849284947GAGCCCGCGGCCATCATAGC851841
113117975277149815000CACGGCTGACAGGGCGCACC941842
113120780882750375056GTCCCCAGTTCCGCGCTTGC9053
113123589191052055224CCAGCTCAGCCGGTCGCGGT721843
113126397799652915310ATGAGTGGGACATGAAGCCT511844
113129110631082N/AN/AGCTTCGCCGGCAAGGCTCCC411845
11313191106112555255544CAGCTCAGTGGGCCGTTCCT661846
11313471141116055605579TCATCGAAGACAGACTCTTG271847
11313751216123556355654AACTGTGGCCCCAGTACAGC171848
113140312891308N/AN/AGGTGCGGGCCGGTCCTGCAG791849
11314311371139060316050GTAGGAGCGCACGGCCAACG461850
11314591445146461886207TCCGCATCCTCCTGAAGGCG401851
11314871521154062646283GGTCTCGGAGGGTCGCGCGG611852
113151515701589N/AN/ACCTCCGCCCCCTCGAACTGG258 1853
11315431613163269116930GAGAGGAACGGTACCTGCGC801854
11315711707172670057024GCACGCATCGGTGCCGCCCT 221855
11315991786180571747193AGCTGATGATGCCTTGCAGG251856
11316271816183572047223GCTTGTTGCGGTCACCACAG211857
11316551863188272517270CTCCCGGATCCAGGCCAGGT811858
11316831906192572947313AAGGAGGGAAAGATGAGTCC481859
11317111943196273317350TTCCATGCCCCAGCCACTCT201860
11317391996201573847403CGCCATCCTGGCGCGGAGCT151861
1131795N/AN/A157176CATGGCTCATGGCTGTGATA821862
1131823N/AN/A253272TGGTTGTCTGTCTCCTCTGC701863
1131851N/AN/A344363CAAGACCCAAACCCTTTCTA154 1864
1131879N/AN/A434453CAGGGAACTGACTATAAGTC741865
1131907N/AN/A579598ACTGCACACACTGCACCATA781866
1131935N/AN/A669688GCCCTCAAGGATCACACAGC801867
1131963N/AN/A838857GTGGCATGAATGATGCCCAT153 1868
1131991N/AN/A931950GCTCATAAGTGATAAAGCTG361869
1132019N/AN/A10431062CACATGGGTTTCCCTTCTCA100 1870
1132047N/AN/A11381157GAAATGGCAGGTACCCTTCA461871
1132075N/AN/A15541573AGGGTAAGGTCCATCTGGTT851872
1132103N/AN/A16881707GTTTGGGTAAGGCAAGAGAG471873
1132131N/AN/A20992118TAAATGGAAATGGATCTGAG371874
1132159N/AN/A22072226TGAAATGCTGAGCAGTGTCT841875
1132187N/AN/A23202339GTTTGCTAGTTCAATGTTCA561876
1132215N/AN/A24552474ATCAGCTTAGCATTGATGAA441877
1132243N/AN/A25702589TGGAAATGGCCTCTGAGCCT521878
1132271N/AN/A27062725CACATTCCCAGTTAAGGTTC301879
1132299N/AN/A28112830ATTGAGAATGTGCCTACTTG871880
1132327N/AN/A29172936GAATGTTGAAGTCACTGTTA741881
1132355N/AN/A30213040ACTCCTGACTCCACAACCTG491882
1132383N/AN/A34153434GGACAGACCCTCAAAAAGGT721883
1132411N/AN/A35053524CAGTGAGAACTGCAGGGACA731884
1132439N/AN/A37003719GCCCTATCACAGTCCCCTCT611885
1132467N/AN/A38683887CGGGAGGAGAGAGCCCCAGG461886
1132495N/AN/A39904009TGGGACCACTCCTTCCCAGA651887
1132523N/AN/A40964115GCAGGGAGCTGAGTCACACA121 1888
1132551N/AN/A42864305GGGTTGCCCCTGTCCCCCAG591889
1132579N/AN/A45144533ATCTGCTCACCCTGGCTGGC481890
1132607N/AN/A46114630GCCTAAAGACCCCCCCAGAG751891
1132635N/AN/A48324851GCTTTCCGCACTCTCCCTCC541892
1132663N/AN/A51495168GGTTCCTGTAGCCACACGAC861893
1132691N/AN/A54835502CGCTTCGCCGGCAAGGCTGT411894
1132719N/AN/A59105929CTCAGACCTGGCCACAAGCG891895
1132747N/AN/A63526371TGATCAAAGGTCTCCTCCCC118 1896
1132775N/AN/A64546473GGGATTCACCTACACATTCT119 1897
1132803N/AN/A66006619ACACTAGCCCGGAGCGCGGG621898
1132831N/AN/A66886707TCCAGAGAAAAGCCAGGATT861899
1132859N/AN/A68056824ACGATGGACAAAGCTGCTCC551900
1132887N/AN/A70727091CTGTGGACCTGAGATTTGTG1551901
TABLE 29
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113075924432443CGTCCGTTGGTCCAGCTGCC351902
113078771907190AAGCTCACCAGCAGGAACCC471903
1130815129148496515AGCTTTGTACTTATGCTCCT441904
1130843163182N/AN/ACCCCGGTGACAGTGAGAACG271905
113087121623535673586GGTACATTTGTGGTACAGCT17183
113087221723635683587GGGTACATTTGTGGTACAGC2325
113090028330237903809ATCGCTGGTCCTGATCAAAG221906
1130928323342N/AN/ACAGTGGTCTTTCACTTTCTT121907
113095637939841874206GGCCGCTTGGCATGTTCACA661908
1130984438457N/AN/AAAAGCACTTCTCTTTCTGGC331909
113101247949844244443CATATCTCATTCTTGTGGAA381910
113104052554444704489ACCCTTGCACTGGCATCTGG221911
113106855857745034522CTGGCTGGCCAGCCGCTGGC261912
113109659761646814700GCAGCGACCCCCATGGAGGC231913
113112463865747224741CCCACCGGGCAGTGGCACAG451914
113115270172049304949CTGAGCCCGCGGCCATCATA351915
113118075377249825001CCACGGCTGACAGGGCGCAC361916
113120881283150415060CCCAGTCCCCAGTTCCGCGC221917
113123689291152065225CCCAGCTCAGCCGGTCGCGG711918
113126497999852935312GCATGAGTGGGACATGAAGC471919
113129210641083N/AN/ACGCTTCGCCGGCAAGGCTCC551920
11313201107112655265545GCAGCTCAGTGGGCCGTTCC711921
11313481143116255625581GGTCATCGAAGACAGACTCT221922
11313761218123756375656GAAACTGTGGCCCCAGTACA321923
11314041302132159625981CGTCAGATCCTCGGGTGCGG291924
11314321372139160326051GGTAGGAGCGCACGGCCAAC221925
11314601446146561896208GTCCGCATCCTCCTGAAGGC311926
11314881522154162656284TGGTCTCGGAGGGTCGCGCG401927
113151615711590N/AN/ATCCTCCGCCCCCTCGAACTG425 1928
11315441614163369126931GGAGAGGAACGGTACCTGCG871929
11315721709172870077026TGGCACGCATCGGTGCCGCC 631930
11316001787180671757194CAGCTGATGATGCCTTGCAG901931
11316281817183672057224GGCTTGTTGCGGTCACCACA401932
11316561864188372527271GCTCCCGGATCCAGGCCAGG561933
11316841907192672957314CAAGGAGGGAAAGATGAGTC331934
11317121944196373327351CTTCCATGCCCCAGCCACTC201935
11317401997201673857404GCGCCATCCTGGCGCGGAGC381936
1131796N/AN/A160179GGCCATGGCTCATGGCTGTG791937
1131824N/AN/A256275GTCTGGTTGTCTGTCTCCTC631938
1131852N/AN/A347366TCCCAAGACCCAAACCCTTT571939
1131880N/AN/A437456AGGCAGGGAACTGACTATAA331940
1131908N/AN/A582601GAGACTGCACACACTGCACC401941
1131936N/AN/A672691CCTGCCCTCAAGGATCACAC451942
1131964N/AN/A841860TGTGTGGCATGAATGATGCC851943
1131992N/AN/A934953CCAGCTCATAAGTGATAAAG361944
1132020N/AN/A10461065CCTCACATGGGTTTCCCTTC261945
1132048N/AN/A11591178TGGCAGAGCTTGAGGAAGGG311946
1132076N/AN/A15571576ACCAGGGTAAGGTCCATCTG651947
1132104N/AN/A16911710CAAGTTTGGGTAAGGCAAGA401948
1132132N/AN/A21022121CAGTAAATGGAAATGGATCT641949
1132160N/AN/A22102229CCATGAAATGCTGAGCAGTG461950
1132188N/AN/A23232342ACTGTTTGCTAGTTCAATGT251951
1132216N/AN/A24582477GCCATCAGCTTAGCATTGAT381952
1132244N/AN/A25732592TTTTGGAAATGGCCTCTGAG711953
1132272N/AN/A27092728TTGCACATTCCCAGTTAAGG581954
1132300N/AN/A28142833TACATTGAGAATGTGCCTAC116 1955
1132328N/AN/A29202939GTTGAATGTTGAAGTCACTG471956
1132356N/AN/A30243043TAGACTCCTGACTCCACAAC110 1957
1132384N/AN/A34183437AAAGGACAGACCCTCAAAAA113 1958
1132412N/AN/A35083527TGACAGTGAGAACTGCAGGG301959
1132440N/AN/A37033722CCTGCCCTATCACAGTCCCC841960
1132468N/AN/A38713890AGGCGGGAGGAGAGAGCCCC621961
1132496N/AN/A39934012AAATGGGACCACTCCTTCCC411962
1132524N/AN/A40994118AGAGCAGGGAGCTGAGTCAC601963
1132552N/AN/A42894308CCAGGGTTGCCCCTGTCCCC190 1964
1132580N/AN/A45174536ACCATCTGCTCACCCTGGCT671965
1132608N/AN/A46144633TGGGCCTAAAGACCCCCCCA741966
1132636N/AN/A48354854TCTGCTTTCCGCACTCTCCC361967
1132664N/AN/A51525171CCGGGTTCCTGTAGCCACAC531968
1132692N/AN/A57025721CGCCGGTCCTGCAGGCAGTG541969
1132720N/AN/A59135932GCTCTCAGACCTGGCCACAA941970
1132748N/AN/A63556374CAGTGATCAAAGGTCTCCTC731971
1132776N/AN/A64576476CCTGGGATTCACCTACACAT461972
1132804N/AN/A66036622CCCACACTAGCCCGGAGCGC521973
1132832N/AN/A66916710AGGTCCAGAGAAAAGCCAGG601974
1132860N/AN/A68086827CGGACGATGGACAAAGCTGC371975
1132888N/AN/A70757094GCGCTGTGGACCTGAGATTT 871976
TABLE 30
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO:NO:NO:NO:
1122SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113078872917291CAAGCTCACCAGCAGGAACC441977
1130816130149497516CAGCTTTGTACTTATGCTCC461978
113084416418335153534TCCCCGGTGACAGTGAGAAC4324
113087121623535673586GGTACATTTGTGGTACAGCT12183
113087321823735693588TGGGTACATTTGTGGTACAG221979
113090128430337913810CATCGCTGGTCCTGATCAAA261980
1130929324343N/AN/AGCAGTGGTCTTTCACTTTCT351981
113095738039941884207GGGCCGCTTGGCATGTTCAC321982
1130985439458N/AN/ACAAAGCACTTCTCTTTCTGG341983
113101348150044264445ACCATATCTCATTCTTGTGG211984
113104152654544714490GACCCTTGCACTGGCATCTG271985
113106955957845044523CCTGGCTGGCCAGCCGCTGG761986
113109759861746824701GGCAGCGACCCCCATGGAGG241987
113112564065947244743AGCCCACCGGGCAGTGGCAC571988
113115370272149314950GCTGAGCCCGCGGCCATCAT361989
113118175477349835002CCCACGGCTGACAGGGCGCA371990
113120981383250425061GCCCAGTCCCCAGTTCCGCG411991
113123789391252075226TCCCAGCTCAGCCGGTCGCG401992
113126598099952945313GGCATGAGTGGGACATGAAG281993
113129310651084N/AN/ACCGCTTCGCCGGCAAGGCTC351994
11313211108112755275546CGCAGCTCAGTGGGCCGTTC321995
11313491144116355635582GGGTCATCGAAGACAGACTC441996
11313771219123856385657AGAAACTGTGGCCCCAGTAC461997
11314051303132259635982CCGTCAGATCCTCGGGTGCG281998
11314331373139260336052CGGTAGGAGCGCACGGCCAA211999
11314611448146761916210CCGTCCGCATCCTCCTGAAG422000
11314891523154262666285GTGGTCTCGGAGGGTCGCGC412001
113151715721591N/AN/ATTCCTCCGCCCCCTCGAACT194 2002
11315451615163469136932GGGAGAGGAACGGTACCTGC652003
11315731710172970087027CTGGCACGCATCGGTGCCGC1212004
11316011788180771767195CCAGCTGATGATGCCTTGCA222005
11316291818183772067225TGGCTTGTTGCGGTCACCAC262006
11316571865188472537272TGCTCCCGGATCCAGGCCAG442007
11316851908192772967315CCAAGGAGGGAAAGATGAGT222008
11317131945196473337352CCTTCCATGCCCCAGCCACT152009
11317411999201873877406CTGCGCCATCCTGGCGCGGA832010
1131797N/AN/A163182AGAGGCCATGGCTCATGGCT912011
1131825N/AN/A259278CCAGTCTGGTTGTCTGTCTC602012
1131853N/AN/A350369TCTTCCCAAGACCCAAACCC652013
1131881N/AN/A440459AGAAGGCAGGGAACTGACTA842014
1131909N/AN/A585604CCTGAGACTGCACACACTGC562015
1131937N/AN/A675694TACCCTGCCCTCAAGGATCA422016
1131965N/AN/A844863CTCTGTGTGGCATGAATGAT712017
1131993N/AN/A937956CACCCAGCTCATAAGTGATA632018
1132021N/AN/A10491068ATACCTCACATGGGTTTCCC592019
1132049N/AN/A11621181CTATGGCAGAGCTTGAGGAA622020
1132077N/AN/A15601579CCCACCAGGGTAAGGTCCAT542021
1132105N/AN/A16941713CACCAAGTTTGGGTAAGGCA342022
1132133N/AN/A21052124GGACAGTAAATGGAAATGGA452023
1132161N/AN/A22192238GAGATAATGCCATGAAATGC562024
1132189N/AN/A23262345AATACTGTTTGCTAGTTCAA522025
1132217N/AN/A24612480AGTGCCATCAGCTTAGCATT512026
1132245N/AN/A25762595GGCTTTTGGAAATGGCCTCT462027
1132273N/AN/A27122731AATTTGCACATTCCCAGTTA642028
1132301N/AN/A28172836TTCTACATTGAGAATGTGCC432029
1132329N/AN/A29232942CTTGTTGAATGTTGAAGTCA502030
1132357N/AN/A30273046GAGTAGACTCCTGACTCCAC732031
1132385N/AN/A34213440GGAAAAGGACAGACCCTCAA722032
1132413N/AN/A35113530CGGTGACAGTGAGAACTGCA322033
1132441N/AN/A37063725CACCCTGCCCTATCACAGTC742034
1132469N/AN/A38743893ATGAGGCGGGAGGAGAGAGC722035
1132497N/AN/A39964015GCAAAATGGGACCACTCCTT422036
1132525N/AN/A41024121GGAAGAGCAGGGAGCTGAGT102 2037
1132553N/AN/A42924311GGCCCAGGGTTGCCCCTGTC752038
1132581N/AN/A45204539CCAACCATCTGCTCACCCTG722039
1132609N/AN/A46174636CCCTGGGCCTAAAGACCCCC115 2040
1132637N/AN/A48384857TCATCTGCTTTCCGCACTCT442041
1132665N/AN/A51555174TGTCCGGGTTCCTGTAGCCA432042
1132693N/AN/A57055724ACTCGCCGGTCCTGCAGGCA292043
1132721N/AN/A60896108GCCCCCACGCACCCAGGTCG132 2044
1132749N/AN/A63586377ACCCAGTGATCAAAGGTCTC562045
1132777N/AN/A64606479CTACCTGGGATTCACCTACA512046
1132805N/AN/A66066625GCTCCCACACTAGCCCGGAG522047
1132833N/AN/A66946713CTGAGGTCCAGAGAAAAGCC252048
1132861N/AN/A68116830GCCCGGACGATGGACAAAGC862049
1132889N/AN/A70917110GGAAACACGCAGCTCAGCGC 872050
TABLE 31
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)No.
113076127462746ATCCGTCCGTTGGTCCAGCT242051
113078973927392CCAAGCTCACCAGCAGGAAC472052
1130817131150498517TCAGCTTTGTACTTATGCTC432053
113084516518435163535CTCCCCGGTGACAGTGAGAA682054
113087121623535673586GGTACATTTGTGGTACAGCT16183
113087422023935713590TGTGGGTACATTTGTGGTAC212055
113090228630537933812CCCATCGCTGGTCCTGATCA252056
1130930326345N/AN/ACTGCAGTGGTCTTTCACTTT562057
113095840041942084227GTTGTGGACAGAGACAGTGG372058
1130986440459N/AN/ATCAAAGCACTTCTCTTTCTG412059
113101448450344294448TATACCATATCTCATTCTTG412060
113104252754644724491GGACCCTTGCACTGGCATCT392061
1131070560579N/AN/AGCCTGGCTGGCCAGCCGCTG822062
113109860061946844703TAGGCAGCGACCCCCATGGA472063
113112664366247274746TGTAGCCCACCGGGCAGTGG242064
113115470372249324951AGCTGAGCCCGCGGCCATCA292065
113118275677549855004GGCCCACGGCTGACAGGGCG612066
113121081583450445063CCGCCCAGTCCCCAGTTCCG272067
113123889491352085227CTCCCAGCTCAGCCGGTCGC662068
1131266989100853035322GGCTGCGCGGGCATGAGTGG662069
11312941066108554855504CCCGCTTCGCCGGCAAGGCT492070
11313221109112855285547CCGCAGCTCAGTGGGCCGTT672071
11313501146116555655584GCGGGTCATCGAAGACAGAC232072
11313781220123956395658CAGAAACTGTGGCCCCAGTA512073
11314061305132459655984CACCGTCAGATCCTCGGGTG312074
11314341375139460356054AGCGGTAGGAGCGCACGGCC242075
11314621449146861926211GCCGTCCGCATCCTCCTGAA172076
11314901524154362676286CGTGGTCTCGGAGGGTCGCG282077
113151815731592N/AN/AATTCCTCCGCCCCCTCGAAC238 2078
11315461616163569146933AGGGAGAGGAACGGTACCTG502079
113157417121731N/AN/ACCCTGGCACGCATCGGTGCC 562080
11316021789180871777196CCCAGCTGATGATGCCTTGC452081
11316301819183872077226CTGGCTTGTTGCGGTCACCA162082
11316581866188572547273GTGCTCCCGGATCCAGGCCA322083
11316861909192872977316ACCAAGGAGGGAAAGATGAG192084
11317141946196573347353GCCTTCCATGCCCCAGCCAC302085
11317422000201973887407CCTGCGCCATCCTGGCGCGG113 2086
1131798N/AN/A166185AGCAGAGGCCATGGCTCATG382087
1131826N/AN/A262281CACCCAGTCTGGTTGTCTGT712088
1131854N/AN/A353372ATTTCTTCCCAAGACCCAAA742089
1131882N/AN/A443462AGAAGAAGGCAGGGAACTGA120 2090
1131910N/AN/A591610GACTGCCCTGAGACTGCACA592091
1131938N/AN/A678697CCATACCCTGCCCTCAAGGA462092
1131966N/AN/A847866GGCCTCTGTGTGGCATGAAT312093
1131994N/AN/A941960GAGTCACCCAGCTCATAAGT802094
1132022N/AN/A10521071TGAATACCTCACATGGGTTT342095
1132050N/AN/A11651184GAGCTATGGCAGAGCTTGAG512096
1132078N/AN/A15631582AGGCCCACCAGGGTAAGGTC612097
1132106N/AN/A17021721GGATAGGGCACCAAGTTTGG772098
1132134N/AN/A21082127CTAGGACAGTAAATGGAAAT332099
1132162N/AN/A22222241CATGAGATAATGCCATGAAA502100
1132190N/AN/A23292348CCTAATACTGTTTGCTAGTT362101
1132218N/AN/A24642483TATAGTGCCATCAGCTTAGC432102
1132246N/AN/A25792598TTTGGCTTTTGGAAATGGCC292103
1132274N/AN/A27152734AAAAATTTGCACATTCCCAG852104
1132302N/AN/A28202839TGGTTCTACATTGAGAATGT762105
1132330N/AN/A29262945ATACTTGTTGAATGTTGAAG522106
1132358N/AN/A30303049CTGGAGTAGACTCCTGACTC622107
1132386N/AN/A34243443TCAGGAAAAGGACAGACCCT362108
1132414N/AN/A35143533CCCCGGTGACAGTGAGAACT332109
1132442N/AN/A37093728GCCCACCCTGCCCTATCACA402110
1132470N/AN/A38773896GTAATGAGGCGGGAGGAGAG462111
1132498N/AN/A39994018CCTGCAAAATGGGACCACTC602112
1132526N/AN/A41054124GAAGGAAGAGCAGGGAGCTG582113
1132554N/AN/A42954314GTAGGCCCAGGGTTGCCCCT712114
1132582N/AN/A45234542TTCCCAACCATCTGCTCACC722115
1132610N/AN/A46204639CACCCCTGGGCCTAAAGACC792116
1132638N/AN/A48414860CTCTCATCTGCTTTCCGCAC602117
1132666N/AN/A51585177CGTTGTCCGGGTTCCTGTAG592118
1132694N/AN/A57085727GGTACTCGCCGGTCCTGCAG372119
1132722N/AN/A61116130TCTCTTCCCGTCCCCGCGGG602120
1132750N/AN/A63616380CTAACCCAGTGATCAAAGGT752121
1132778N/AN/A64636482ATTCTACCTGGGATTCACCT342122
1132806N/AN/A66096628CTGGCTCCCACACTAGCCCG442123
1132834N/AN/A66976716AGGCTGAGGTCCAGAGAAAA962124
1132862N/AN/A68146833GCCGCCCGGACGATGGACAA972125
1132890N/AN/A70947113GTCGGAAACACGCAGCTCAG 902126
TABLE 32
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)No.
113076228472847CATCCGTCCGTTGGTCCAGC462127
113079074937493TCCAAGCTCACCAGCAGGAA412128
1130818132151499518TTCAGCTTTGTACTTATGCT632129
113084616618535173536GCTCCCCGGTGACAGTGAGA162130
113087121623535673586GGTACATTTGTGGTACAGCT15183
113087522124035723591TTGTGGGTACATTTGTGGTA312131
113090328730637943813CCCCATCGCTGGTCCTGATC202132
1130931328347N/AN/ATGCTGCAGTGGTCTTTCACT552133
113095940142042094228TGTTGTGGACAGAGACAGTG672134
1130987443462N/AN/AGGCTCAAAGCACTTCTCTTT152135
113101548550444304449CTATACCATATCTCATTCTT202136
113104352954844744493CAGGACCCTTGCACTGGCAT382137
1131071561580N/AN/AGGCCTGGCTGGCCAGCCGCT114 2138
113109960162046854704CTAGGCAGCGACCCCCATGG402139
113112764866747324751TCCGGTGTAGCCCACCGGGC104 2140
113115570472349334952TAGCTGAGCCCGCGGCCATC222141
113118375977849885007CGAGGCCCACGGCTGACAGG512142
113121181683550455064GCCGCCCAGTCCCCAGTTCC412143
113123989691552105229TACTCCCAGCTCAGCCGGTC492144
1131267990100953045323CGGCTGCGCGGGCATGAGTG712145
11312951067108654865505TCCCGCTTCGCCGGCAAGGC362146
11313231110112955295548CCCGCAGCTCAGTGGGCCGT332147
11313511147116655665585CGCGGGTCATCGAAGACAGA392148
11313791221124056405659GCAGAAACTGTGGCCCCAGT562149
11314071308132759685987CACCACCGTCAGATCCTCGG402150
11314351376139560366055AAGCGGTAGGAGCGCACGGC252151
11314631451147061946213CTGCCGTCCGCATCCTCCTG222152
11314911542156162856304GCCGGCCACCTGGCAGAGCG872153
113151915741593N/AN/ATATTCCTCCGCCCCCTCGAA316 2154
11315471617163669156934CAGGGAGAGGAACGGTACCT116 2155
11315751743176271317150GTCCTCACACACCAGCGGGC 1479
11316031790180971787197CCCCAGCTGATGATGCCTTG502156
11316311820183972087227CCTGGCTTGTTGCGGTCACC3885
11316591867188672557274TGTGCTCCCGGATCCAGGCC422157
11316871911193072997318TCACCAAGGAGGGAAAGATG172158
11317151947196673357354TGCCTTCCATGCCCCAGCCA36156
11317432001202073897408TCCTGCGCCATCCTGGCGCG302159
1131799N/AN/A169188ATGAGCAGAGGCCATGGCTC992160
1131827N/AN/A265284ATCCACCCAGTCTGGTTGTC892161
1131855N/AN/A356375GAGATTTCTTCCCAAGACCC107 2162
1131883N/AN/A446465GAGAGAAGAAGGCAGGGAAC126 2163
1131911N/AN/A594613CTAGACTGCCCTGAGACTGC722164
1131939N/AN/A681700AGCCCATACCCTGCCCTCAA382165
1131967N/AN/A850869CCTGGCCTCTGTGTGGCATG632166
1131995N/AN/A947966CGCCCAGAGTCACCCAGCTC342167
1132023N/AN/A10551074GGCTGAATACCTCACATGGG742168
1132051N/AN/A11881207TCTGGAAGAATGAAAGCAAT622169
1132079N/AN/A15661585GTCAGGCCCACCAGGGTAAG472170
1132107N/AN/A17051724CAAGGATAGGGCACCAAGTT562171
1132135N/AN/A21142133CCAGAACTAGGACAGTAAAT522172
1132163N/AN/A22252244CTTCATGAGATAATGCCATG462173
1132191N/AN/A23322351GAACCTAATACTGTTTGCTA272174
1132219N/AN/A24672486TGCTATAGTGCCATCAGCTT602175
1132247N/AN/A25822601GGATTTGGCTTTTGGAAATG422176
1132275N/AN/A27182737GTGAAAAATTTGCACATTCC502177
1132303N/AN/A28232842CTCTGGTTCTACATTGAGAA362178
1132331N/AN/A29292948ATAATACTTGTTGAATGTTG392179
1132359N/AN/A30333052TAGCTGGAGTAGACTCCTGA922180
1132387N/AN/A34273446TGGTCAGGAAAAGGACAGAC212181
1132415N/AN/A36053624TAGTCTTACCAGGGCTGAGG502182
1132443N/AN/A37343753CTTCCCTGCTCTACCCAGGG562183
1132471N/AN/A38803899AGAGTAATGAGGCGGGAGGA442184
1132499N/AN/A40024021CCACCTGCAAAATGGGACCA292185
1132527N/AN/A41104129TGGTGGAAGGAAGAGCAGGG902186
1132555N/AN/A42984317TCTGTAGGCCCAGGGTTGCC732187
1132583N/AN/A45264545CCGTTCCCAACCATCTGCTC422188
1132611N/AN/A46234642AGCCACCCCTGGGCCTAAAG150 2189
1132639N/AN/A48444863TCCCTCTCATCTGCTTTCCG262190
1132667N/AN/A53745393CCACTTCCTAACCTCCCGGG129 2191
1132695N/AN/A57115730GCGGGTACTCGCCGGTCCTG582192
1132723N/AN/A61146133AGCTCTCTTCCCGTCCCCGC672193
1132751N/AN/A63646383CGCCTAACCCAGTGATCAAA912194
1132779N/AN/A64726491GGCCCTGGGATTCTACCTGG502195
1132807N/AN/A66126631AACCTGGCTCCCACACTAGC512196
1132835N/AN/A67036722GCAAGGAGGCTGAGGTCCAG392197
1132863N/AN/A68176836CTTGCCGCCCGGACGATGGA502198
1132891N/AN/A70977116TGGGTCGGAAACACGCAGCT1152199
TABLE 33
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)No.
113076330493049GGCATCCGTCCGTTGGTCCA212200
113079175947594CTCCAAGCTCACCAGCAGGA372201
1130819133152500519CTTCAGCTTTGTACTTATGC702202
113084716818735193538GGGCTCCCCGGTGACAGTGA332203
113087121623535673586GGTACATTTGTGGTACAGCT14183
113087622224135733592CTTGTGGGTACATTTGTGGT282204
113090428830737953814TCCCCATCGCTGGTCCTGAT432205
1130932329348N/AN/ATTGCTGCAGTGGTCTTTCAC242206
113096040242142104229GTGTTGTGGACAGAGACAGT342207
1130988444463N/AN/AAGGCTCAAAGCACTTCTCTT232208
113101648750644324451TTCTATACCATATCTCATTC302209
113104453054944754494TCAGGACCCTTGCACTGGCA312210
1131072563582N/AN/ACAGGCCTGGCTGGCCAGCCG412211
113110060362246874706CTCTAGGCAGCGACCCCCAT222212
113112864966847334752CTCCGGTGTAGCCCACCGGG442213
113115670672549354954GGTAGCTGAGCCCGCGGCCA292214
113118476077949895008CCGAGGCCCACGGCTGACAG782215
113121281983850485067GTGGCCGCCCAGTCCCCAGT522216
113124089791652115230GTACTCCCAGCTCAGCCGGT332217
1131268991101053055324CCGGCTGCGCGGGCATGAGT292218
11312961068108754875506CTCCCGCTTCGCCGGCAAGG352219
11313241113113255325551CTGCCCGCAGCTCAGTGGGC532220
11313521149116855685587GACGCGGGTCATCGAAGACA302221
11313801222124156415660CGCAGAAACTGTGGCCCCAG312222
11314081309132859695988GCACCACCGTCAGATCCTCG492223
11314361377139660376056CAAGCGGTAGGAGCGCACGG332224
11314641452147161956214GCTGCCGTCCGCATCCTCCT382225
11314921544156362876306CAGCCGGCCACCTGGCAGAG632226
113152015751594N/AN/AATATTCCTCCGCCCCCTCGA216 2227
11315481618163769166935CCAGGGAGAGGAACGGTACC119 2228
11316041791181071797198TCCCCAGCTGATGATGCCTT292229
11316321821184072097228GCCTGGCTTGTTGCGGTCAC272230
11316601868188772567275GTGTGCTCCCGGATCCAGGC432231
11316881913193273017320AATCACCAAGGAGGGAAAGA142232
11317161948196773367355TTGCCTTCCATGCCCCAGCC192233
11317442003202273917410GTTCCTGCGCCATCCTGGCG 72234
1131772N/AN/A88107CCGAAAGTGTTGACTCCAAG642235
1131800N/AN/A172191GTCATGAGCAGAGGCCATGG432236
1131828N/AN/A268287TGTATCCACCCAGTCTGGTT702237
1131856N/AN/A359378GCAGAGATTTCTTCCCAAGA532238
1131884N/AN/A451470CAAGGGAGAGAAGAAGGCAG752239
1131912N/AN/A597616AGACTAGACTGCCCTGAGAC402240
1131940N/AN/A684703CACAGCCCATACCCTGCCCT572241
1131968N/AN/A853872GGCCCTGGCCTCTGTGTGGC702242
1131996N/AN/A951970CCCTCGCCCAGAGTCACCCA582243
1132024N/AN/A10581077ATGGGCTGAATACCTCACAT442244
1132052N/AN/A11911210GTGTCTGGAAGAATGAAAGC452245
1132080N/AN/A15691588CAAGTCAGGCCCACCAGGGT472246
1132108N/AN/A17081727AGGCAAGGATAGGGCACCAA442247
1132136N/AN/A21172136AAACCAGAACTAGGACAGTA522248
1132164N/AN/A22282247GGGCTTCATGAGATAATGCC632249
1132192N/AN/A23352354CAGGAACCTAATACTGTTTG662250
1132220N/AN/A24702489GTGTGCTATAGTGCCATCAG442251
1132248N/AN/A26012620CACTTTGTGCTTTTGCTGGG592252
1132276N/AN/A27212740GCAGTGAAAAATTTGCACAT412253
1132304N/AN/A28262845CTTCTCTGGTTCTACATTGA522254
1132332N/AN/A29332952CTTAATAATACTTGTTGAAT562255
1132360N/AN/A30363055AGATAGCTGGAGTAGACTCC572256
1132388N/AN/A34303449GTCTGGTCAGGAAAAGGACA742257
1132416N/AN/A36253644CCTGCTCCAACTCCTCTGCG272258
1132444N/AN/A37373756AGGCTTCCCTGCTCTACCCA612259
1132472N/AN/A38833902AGGAGAGTAATGAGGCGGGA462260
1132500N/AN/A40094028GGTTTACCCACCTGCAAAAT362261
1132528N/AN/A41134132ACATGGTGGAAGGAAGAGCA352262
1132556N/AN/A43014320TATTCTGTAGGCCCAGGGTT712263
1132584N/AN/A45294548GGCCCGTTCCCAACCATCTG432264
1132612N/AN/A46264645GTGAGCCACCCCTGGGCCTA802265
1132640N/AN/A48484867TGCCTCCCTCTCATCTGCTT742266
1132668N/AN/A53775396CCCCCACTTCCTAACCTCCC602267
1132696N/AN/A57455764GAGGAGCCGCGGCCCCTGGG702268
1132724N/AN/A61176136CCAAGCTCTCTTCCCGTCCC602269
1132752N/AN/A63676386TTCCGCCTAACCCAGTGATC682270
1132780N/AN/A64756494CCAGGCCCTGGGATTCTACC462271
1132808N/AN/A66156634CAGAACCTGGCTCCCACACT832272
1132836N/AN/A67066725TAGGCAAGGAGGCTGAGGTC802273
1132864N/AN/A68206839ACGCTTGCCGCCCGGACGAT832274
1132892N/AN/A71007119CCCTGGGTCGGAAACACGCA 502275
TABLE 34
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)No.
113076431503150TGGCATCCGTCCGTTGGTCC452276
113079277967796GACTCCAAGCTCACCAGCAG692277
1130820134153501520TCTTCAGCTTTGTACTTATG432278
113084816918835203539AGGGCTCCCCGGTGACAGTG302279
113087121623535673586GGTACATTTGTGGTACAGCT17183
113087722424335753594CCCTTGTGGGTACATTTGTG452280
113090528930837963815ATCCCCATCGCTGGTCCTGA482281
1130933330349N/AN/ATTTGCTGCAGTGGTCTTTCA372282
113096140342242114230GGTGTTGTGGACAGAGACAG432283
113098944546443904409GAGGCTCAAAGCACTTCTCT322284
113101748850744334452GTTCTATACCATATCTCATT372285
113104553155044764495ATCAGGACCCTTGCACTGGC382286
1131073564583N/AN/AGCAGGCCTGGCTGGCCAGCC502287
113110160462346884707CCTCTAGGCAGCGACCCCCA412288
113112965167047354754GGCTCCGGTGTAGCCCACCG602289
113115770772649364955CGGTAGCTGAGCCCGCGGCC552290
113118576178049905009TCCGAGGCCCACGGCTGACA492291
1131213836855N/AN/AGGGTTCCGGCAGAAGGCGTG662292
113124189991852135232CAGTACTCCCAGCTCAGCCG382293
1131269992101153065325GCCGGCTGCGCGGGCATGAG512294
11312971070108954895508TGCTCCCGCTTCGCCGGCAA302295
11313251115113455345553CGCTGCCCGCAGCTCAGTGG452296
11313531150116955695588CGACGCGGGTCATCGAAGAC672297
11313811223124256425661GCGCAGAAACTGTGGCCCCA47112
11314091310132959705989AGCACCACCGTCAGATCCTC182298
11314371378139760386057GCAAGCGGTAGGAGCGCACG502299
11314651455147461986217GCAGCTGCCGTCCGCATCCT4570
11314931547156662906309CCCCAGCCGGCCACCTGGCA742300
113152115771596N/AN/AGCATATTCCTCCGCCCCCTC148 2301
11315491619163869176936TCCAGGGAGAGGAACGGTAC130 2302
11315771745176471337152TGGTCCTCACACACCAGCGG  62303
11316051792181171807199ATCCCCAGCTGATGATGCCT282304
11316331822184172107229CGCCTGGCTTGTTGCGGTCA342305
11316611869188872577276GGTGTGCTCCCGGATCCAGG392306
11316891914193373027321GAATCACCAAGGAGGGAAAG212307
11317171949196873377356CTTGCCTTCCATGCCCCAGC242308
11317452004202373927411AGTTCCTGCGCCATCCTGGC252309
1131773N/AN/A91110TCACCGAAAGTGTTGACTCC872310
1131801N/AN/A175194CAGGTCATGAGCAGAGGCCA702311
1131829N/AN/A271290CCTTGTATCCACCCAGTCTG762312
1131857N/AN/A365384AGAAATGCAGAGATTTCTTC912313
1131885N/AN/A454473CTACAAGGGAGAGAAGAAGG882314
1131913N/AN/A600619ACTAGACTAGACTGCCCTGA772315
1131941N/AN/A687706AGACACAGCCCATACCCTGC412316
1131969N/AN/A856875GAAGGCCCTGGCCTCTGTGT312317
1131997N/AN/A954973AATCCCTCGCCCAGAGTCAC902318
1132025N/AN/A10611080GTGATGGGCTGAATACCTCA492319
1132053N/AN/A11941213TTAGTGTCTGGAAGAATGAA602320
1132081N/AN/A15721591CACCAAGTCAGGCCCACCAG802321
1132109N/AN/A17111730ATTAGGCAAGGATAGGGCAC322322
1132137N/AN/A21202139ACCAAACCAGAACTAGGACA562323
1132165N/AN/A22502269CTTCTTCAGAGGAATTGTCG592324
1132193N/AN/A23382357TCACAGGAACCTAATACTGT612325
1132221N/AN/A24732492GGTGTGTGCTATAGTGCCAT592326
1132249N/AN/A26042623TCACACTTTGTGCTTTTGCT352327
1132277N/AN/A27242743AGAGCAGTGAAAAATTTGCA442328
1132305N/AN/A28292848ATTCTTCTCTGGTTCTACAT562329
1132333N/AN/A29362955GCACTTAATAATACTTGTTG412330
1132361N/AN/A30393058GTCAGATAGCTGGAGTAGAC362331
1132389N/AN/A34333452AGGGTCTGGTCAGGAAAAGG472332
1132417N/AN/A36283647GCCCCTGCTCCAACTCCTCT632333
1132445N/AN/A37403759ACAAGGCTTCCCTGCTCTAC102 2334
1132473N/AN/A38863905ACCAGGAGAGTAATGAGGCG472335
1132501N/AN/A40124031CTTGGTTTACCCACCTGCAA592336
1132529N/AN/A41164135TGGACATGGTGGAAGGAAGA942337
1132557N/AN/A43044323ACCTATTCTGTAGGCCCAGG532338
1132585N/AN/A45324551CCTGGCCCGTTCCCAACCAT642339
1132613N/AN/A46294648GCAGTGAGCCACCCCTGGGC722340
1132641N/AN/A48514870TCCTGCCTCCCTCTCATCTG662341
1132669N/AN/A53805399CCCCCCCCACTTCCTAACCT842342
1132697N/AN/A57485767ACGGAGGAGCCGCGGCCCCT522343
1132725N/AN/A61206139GCCCCAAGCTCTCTTCCCGT120 2344
1132753N/AN/A63706389TTCTTCCGCCTAACCCAGTG712345
1132781N/AN/A64786497ATCCCAGGCCCTGGGATTCT792346
1132809N/AN/A66186637TCGCAGAACCTGGCTCCCAC602347
1132837N/AN/A67096728TCATAGGCAAGGAGGCTGAG782348
1132865N/AN/A68366855CACACCCCATCTGACAACGC822349
1132893N/AN/A71037122TCACCCTGGGTCGGAAACAC 732350
TABLE 35
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113079378977897TGACTCCAAGCTCACCAGCA34239
1130821135154502521CTCTTCAGCTTTGTACTTAT42240
113084917119035223541GCAGGGCTCCCCGGTGACAG34241
113087121623535673586GGTACATTTGTGGTACAGCT11183
113087822524435763595GCCCTTGTGGGTACATTTGT33242
113090629030937973816TATCCCCATCGCTGGTCCTG26243
1130934331350N/AN/AGTTTGCTGCAGTGGTCTTTC21244
113096240442342124231AGGTGTTGTGGACAGAGACA45245
113099044646543914410TGAGGCTCAAAGCACTTCTC18246
113101848950844344453AGTTCTATACCATATCTCAT13247
113104653255144774496CATCAGGACCCTTGCACTGG26248
1131074566585N/AN/ACGGCAGGCCTGGCTGGCCAG70249
113110260662546904709CACCTCTAGGCAGCGACCCC28250
113113065367247374756AAGGCTCCGGTGTAGCCCAC66251
113115870972849384957CGCGGTAGCTGAGCCCGCGG98252
113118676278149915010CTCCGAGGCCCACGGCTGAC40253
1131214839858N/AN/ATCCGGGTTCCGGCAGAAGGC3955
113124290292152165235TCGCAGTACTCCCAGCTCAG16254
1131270993101253075326TGCCGGCTGCGCGGGCATGA41255
11312981071109054905509CTGCTCCCGCTTCGCCGGCA27256
11313261116113555355554CCGCTGCCCGCAGCTCAGTG34257
11313541152117155715590AACGACGCGGGTCATCGAAG36258
11313821224124356435662GGCGCAGAAACTGTGGCCCC59259
11314101311133059715990GAGCACCACCGTCAGATCCT18260
11314381380139960406059GTGCAAGCGGTAGGAGCGCA40261
11314661459147862026221GCGCGCAGCTGCCGTCCGCA36262
11314941548156762916310GCCCCAGCCGGCCACCTGGC62263
113152215781597N/AN/AGGCATATTCCTCCGCCCCCT79264
11315501620163969186937CTCCAGGGAGAGGAACGGTA74265
11315781746176571347153TTGGTCCTCACACACCAGCG  8266
11316061793181271817200GATCCCCAGCTGATGATGCC31267
11316341823184272117230ACGCCTGGCTTGTTGCGGTC31268
11316621870188972587277CGGTGTGCTCCCGGATCCAG22269
11316901915193473037322GGAATCACCAAGGAGGGAAA20270
11317181950196973387357TCTTGCCTTCCATGCCCCAG17271
11317462005202473937412GAGTTCCTGCGCCATCCTGG 7159
1131774N/AN/A94113CACTCACCGAAAGTGTTGAC78272
1131802N/AN/A178197CCACAGGTCATGAGCAGAGG58273
1131830N/AN/A274293TGCCCTTGTATCCACCCAGT97274
1131858N/AN/A368387CCCAGAAATGCAGAGATTTC98275
1131886N/AN/A457476AATCTACAAGGGAGAGAAGA79276
1131914N/AN/A603622GGCACTAGACTAGACTGCCC67?77
1131942N/AN/A690709CTTAGACACAGCCCATACCC60278
1131970N/AN/A859878ATTGAAGGCCCTGGCCTCTG62279
1131998N/AN/A957976TCAAATCCCTCGCCCAGAGT81280
1132026N/AN/A10641083CAGGTGATGGGCTGAATACC81281
1132054N/AN/A11971216AATTTAGTGTCTGGAAGAAT70282
1132082N/AN/A15751594CCCCACCAAGTCAGGCCCAC78283
1132110N/AN/A17471766TGGACGGACAGAGAGGAGGG71284
1132138N/AN/A21232142AGGACCAAACCAGAACTAGG58285
1132166N/AN/A22532272TGTCTTCTTCAGAGGAATTG66286
1132194N/AN/A23412360GGCTCACAGGAACCTAATAC47287
1132222N/AN/A24792498GATTCAGGTGTGTGCTATAG53288
1132250N/AN/A26092628GTTTTTCACACTTTGTGCTT51289
1132278N/AN/A27342753GGGCATGCACAGAGCAGTGA52290
1132306N/AN/A28322851CTCATTCTTCTCTGGTTCTA48291
1132334N/AN/A29392958TAGGCACTTAATAATACTTG56292
1132362N/AN/A30423061GGAGTCAGATAGCTGGAGTA69293
1132390N/AN/A34363455CTCAGGGTCTGGTCAGGAAA70294
1132418N/AN/A36313650CAGGCCCCTGCTCCAACTCC65295
1132446N/AN/A37433762GAGACAAGGCTTCCCTGCTC71296
1132474N/AN/A38893908GATACCAGGAGAGTAATGAG55297
1132502N/AN/A40154034AAGCTTGGTTTACCCACCTG46298
1132530N/AN/A41224141GAGAGATGGACATGGTGGAA67299
1132558N/AN/A43104329CCAGCAACCTATTCTGTAGG56300
1132586N/AN/A45354554CTCCCTGGCCCGTTCCCAAC68301
1132614N/AN/A46324651AACGCAGTGAGCCACCCCTG32302
1132642N/AN/A48594878CTGGGCTCTCCTGCCTCCCT31303
1132670N/AN/A53835402TTCCCCCCCCCACTTCCTAA106 304
1132698N/AN/A57515770GAGACGGAGGAGCCGCGGCC72305
1132726N/AN/A61586177AACCCGGGCGGAGAGGAGCG98306
1132754N/AN/A63736392GGCTTCTTCCGCCTAACCCA72307
1132782N/AN/A64816500TGAATCCCAGGCCCTGGGAT101 308
1132810N/AN/A66216640GAGTCGCAGAACCTGGCTCC71309
1132838N/AN/A67126731ATTTCATAGGCAAGGAGGCT66310
1132866N/AN/A68396858CTTCACACCCCATCTGACAA108 311
1132894N/AN/A71067125GAATCACCCTGGGTCGGAAA 76312
TABLE 36
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113079479987998TTGACTCCAAGCTCACCAGC41315
1130822136155503522GCTCTTCAGCTTTGTACTTA34316
113085017219135233542GGCAGGGCTCCCCGGTGACA19317
113087121623535673586GGTACATTTGTGGTACAGCT12183
113087922624535773596GGCCCTTGTGGGTACATTTG66318
113090729231137993818AGTATCCCCATCGCTGGTCC19319
1130935332351N/AN/ATGTTTGCTGCAGTGGTCTTT27320
113096340542442134232GAGGTGTTGTGGACAGAGAC47321
113099144746643924411CTGAGGCTCAAAGCACTTCT29322
113101949351244384457GCTCAGTTCTATACCATATC17323
113104753355244784497GCATCAGGACCCTTGCACTG26324
1131075568587N/AN/ATGCGGCAGGCCTGGCTGGCC50325
113110360762646914710CCACCTCTAGGCAGCGACCC29326
113113165467347384757GAAGGCTCCGGTGTAGCCCA56327
113115971072949394958CCGCGGTAGCTGAGCCCGCG77328
113118776378249925011CCTCCGAGGCCCACGGCTGA47329
1131215840859N/AN/AGTCCGGGTTCCGGCAGAAGG38313
113124390392252175236GTCGCAGTACTCCCAGCTCA12330
1131271994101353085327GTGCCGGCTGCGCGGGCATG63331
11312991072109154915510GCTGCTCCCGCTTCGCCGGC26332
11313271117113655365555GCCGCTGCCCGCAGCTCAGT30333
11313551153117255725591CAACGACGCGGGTCATCGAA53334
11313831225124456445663CGGCGCAGAAACTGTGGCCC46335
11314111312133159725991CGAGCACCACCGTCAGATCC17336
11314391381140060416060CGTGCAAGCGGTAGGAGCGC27337
11314671460147962036222AGCGCGCAGCTGCCGTCCGC42338
11314951549156862926311GGCCCCAGCCGGCCACCTGG82339
113152315791598N/AN/ATGGCATATTCCTCCGCCCCC67340
11315511621164069196938GCTCCAGGGAGAGGAACGGT66341
11315791747176671357154CTTGGTCCTCACACACCAGC 36342
11316071794181371827201CGATCCCCAGCTGATGATGC41343
11316351839185872277246GGCCACATCGGTGTAGACGC1886
11316631871189072597278ACGGTGTGCTCCCGGATCCA16344
11316911916193573047323CGGAATCACCAAGGAGGGAA15345
11317191951197073397358ATCTTGCCTTCCATGCCCCA28346
11317472006202573947413TGAGTTCCTGCGCCATCCTG17347
1131775N/AN/A97116CAGCACTCACCGAAAGTGTT84348
1131803N/AN/A181200GACCCACAGGTCATGAGCAG87349
1131831N/AN/A277296CTGTGCCCTTGTATCCACCC61350
1131859N/AN/A371390CAGCCCAGAAATGCAGAGAT69351
1131887N/AN/A460479TGGAATCTACAAGGGAGAGA89352
1131915N/AN/A606625GTAGGCACTAGACTAGACTG52353
1131943N/AN/A693712GCACTTAGACACAGCCCATA64354
1131971N/AN/A862881CCCATTGAAGGCCCTGGCCT49355
1131999N/AN/A960979AACTCAAATCCCTCGCCCAG59356
1132027N/AN/A10671086CACCAGGTGATGGGCTGAAT49357
1132055N/AN/A12001219GGTAATTTAGTGTCTGGAAG46358
1132083N/AN/A15781597CAACCCCACCAAGTCAGGCC69359
1132111N/AN/A17501769GGATGGACGGACAGAGAGGA63360
1132139N/AN/A21262145CCAAGGACCAAACCAGAACT56361
1132167N/AN/A22562275CTGTGTCTTCTTCAGAGGAA50362
1132195N/AN/A23702389TGTTGGTTGATGAAAATGTT54363
1132223N/AN/A24822501CTTGATTCAGGTGTGTGCTA50364
1132251N/AN/A26282647TCAGTCTACTTAGTGCAACG51365
1132279N/AN/A27392758TTTGTGGGCATGCACAGAGC53366
1132307N/AN/A28352854ATCCTCATTCTTCTCTGGTT53367
1132335N/AN/A29422961AAGTAGGCACTTAATAATAC67368
1132363N/AN/A30453064TCAGGAGTCAGATAGCTGGA77369
1132391N/AN/A34393458TCCCTCAGGGTCTGGTCAGG54370
1132419N/AN/A36373656GTCTCCCAGGCCCCTGCTCC56371
1132447N/AN/A37493768TAGAAAGAGACAAGGCTTCC61372
1132475N/AN/A38923911GGTGATACCAGGAGAGTAAT47373
1132503N/AN/A40184037TCCAAGCTTGGTTTACCCAC38374
1132531N/AN/A41254144TCTGAGAGATGGACATGGTG68375
1132559N/AN/A43134332TATCCAGCAACCTATTCTGT69376
1132587N/AN/A45384557CTCCTCCCTGGCCCGTTCCC70377
1132615N/AN/A46354654GGGAACGCAGTGAGCCACCC49378
1132643N/AN/A48624881AGGCTGGGCTCTCCTGCCTC75379
1132671N/AN/A53865405TCCTTCCCCCCCCCACTTCC92380
1132699N/AN/A57545773TGGGAGACGGAGGAGCCGCG61381
1132727N/AN/A61616180GCTAACCCGGGCGGAGAGGA101 382
1132755N/AN/A63766395GCGGGCTTCTTCCGCCTAAC56383
1132783N/AN/A64846503CAGTGAATCCCAGGCCCTGG66384
1132811N/AN/A66246643CCAGAGTCGCAGAACCTGGC56385
1132839N/AN/A67156734TCAATTTCATAGGCAAGGAG64386
1132867N/AN/A68426861CTTCTTCACACCCCATCTGA88387
1132895N/AN/A71097128CCGGAATCACCCTGGGTCGG 28388
TABLE 37
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113079580998099GTTGACTCCAAGCTCACCAG40389
1130823138157505524GTGCTCTTCAGCTTTGTACT38390
113085117419335253544GTGGCAGGGCTCCCCGGTGA80391
113087121623535673586GGTACATTTGTGGTACAGCT11183
113088022824735793598CCGGCCCTTGTGGGTACATT42392
113090829331238003819CAGTATCCCCATCGCTGGTC24393
1130936333352N/AN/AGTGTTTGCTGCAGTGGTCTT32394
113096440642542144233TGAGGTGTTGTGGACAGAGA112 395
113099244946843944413AGCTGAGGCTCAAAGCACTT45396
113102049451344394458TGCTCAGTTCTATACCATAT23397
113104853555444804499GGGCATCAGGACCCTTGCAC81398
1131076569588N/AN/AGTGCGGCAGGCCTGGCTGGC54399
113110460962846934712CTCCACCTCTAGGCAGCGAC45400
113113265567447394758AGAAGGCTCCGGTGTAGCCC69401
113116071173049404959GCCGCGGTAGCTGAGCCCGC97402
113118876578449945013GGCCTCCGAGGCCCACGGCT45403
1131216843862N/AN/AGTTGTCCGGGTTCCGGCAGA20404
113124490492352185237GGTCGCAGTACTCCCAGCTC32405
1131272996101553105329CGGTGCCGGCTGCGCGGGCA59406
11313001073109254925511GGCTGCTCCCGCTTCGCCGG50407
11313281118113755375556AGCCGCTGCCCGCAGCTCAG83408
11313561155117455745593GCCAACGACGCGGGTCATCG38409
11313841227124656465665GCCGGCGCAGAAACTGTGGC68410
11314121313133259735992CCGAGCACCACCGTCAGATC47411
11314401399141860596078TGACGGGCGAGAAGGCCTCG59412
11314681462148162056224GGAGCGCGCAGCTGCCGTCC44413
11314961550156962936312TGGCCCCAGCCGGCCACCTG96414
11315241581160068796898GCTGGCATATTCCTCCGCCC64415
11315521622164169206939CGCTCCAGGGAGAGGAACGG107 416
11315801748176771367155GCTTGGTCCTCACACACCAG 1080
11316081795181471837202CCGATCCCCAGCTGATGATG28417
11316361842186172307249GTAGGCCACATCGGTGTAGA51418
11316641873189272617280AAACGGTGTGCTCCCGGATC81419
11316921917193673057324GCGGAATCACCAAGGAGGGA18420
11317201952197173407359AATCTTGCCTTCCATGCCCC30421
11317482007202673957414TTGAGTTCCTGCGCCATCCT11422
1131776N/AN/A100119CCACAGCACTCACCGAAAGT116 423
1131804N/AN/A184203CTGGACCCACAGGTCATGAG48424
1131832N/AN/A280299AGGCTGTGCCCTTGTATCCA45425
1131860N/AN/A374393TCACAGCCCAGAAATGCAGA144 426
1131888N/AN/A463482AGGTGGAATCTACAAGGGAG72427
1131916N/AN/A609628CAGGTAGGCACTAGACTAGA85428
1131944N/AN/A696715TGGGCACTTAGACACAGCCC56429
1131972N/AN/A865884TTGCCCATTGAAGGCCCTGG60430
1132000N/AN/A963982GAGAACTCAAATCCCTCGCC77431
1132028N/AN/A10701089ATGCACCAGGTGATGGGCTG65432
1132056N/AN/A12031222GTAGGTAATTTAGTGTCTGG89433
1132084N/AN/A15811600ACTCAACCCCACCAAGTCAG75434
1132112N/AN/A17531772ATGGGATGGACGGACAGAGA60435
1132140N/AN/A21292148TTGCCAAGGACCAAACCAGA87436
1132168N/AN/A22592278TGCCTGTGTCTTCTTCAGAG51437
1132196N/AN/A23732392TGCTGTTGGTTGATGAAAAT51438
1132224N/AN/A24852504ACACTTGATTCAGGTGTGTG64439
1132252N/AN/A26342653TCCTTCTCAGTCTACTTAGT53440
1132280N/AN/A27422761CCATTTGTGGGCATGCACAG60441
1132308N/AN/A28382857TTGATCCTCATTCTTCTCTG44442
1132336N/AN/A29502969TTGCCACAAAGTAGGCACTT66443
1132364N/AN/A30483067GGTTCAGGAGTCAGATAGCT74444
1132392N/AN/A34423461CTGTCCCTCAGGGTCTGGTC74445
1132420N/AN/A36403659CATGTCTCCCAGGCCCCTGC49446
1132448N/AN/A37523771CTGTAGAAAGAGACAAGGCT52447
1132476N/AN/A38953914TCTGGTGATACCAGGAGAGT50448
1132504N/AN/A40214040GTTTCCAAGCTTGGTTTACC61449
1132532N/AN/A41284147TGGTCTGAGAGATGGACATG40450
1132560N/AN/A43164335GAGTATCCAGCAACCTATTC46451
1132588N/AN/A45414560ACGCTCCTCCCTGGCCCGTT85452
1132616N/AN/A46384657GGAGGGAACGCAGTGAGCCA83453
1132644N/AN/A48664885GCCAAGGCTGGGCTCTCCTG43454
1132672N/AN/A53895408TCCTCCTTCCCCCCCCCACT99455
1132700N/AN/A57575776CGCTGGGAGACGGAGGAGCC98456
1132728N/AN/A61646183AGAGCTAACCCGGGCGGAGA69457
1132756N/AN/A63796398GTCGCGGGCTTCTTCCGCCT46458
1132784N/AN/A64876506CAGCAGTGAATCCCAGGCCC63459
1132812N/AN/A66276646CATCCAGAGTCGCAGAACCT48460
1132840N/AN/A67186737AATTCAATTTCATAGGCAAG69461
1132868N/AN/A68456864CGCCTTCTTCACACCCCATC97462
1132896N/AN/A71127131CCTCCGGAATCACCCTGGGT 53463
TABLE 38
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
11307968210182101GTGTTGACTCCAAGCTCACC34465
1130824139158506525TGTGCTCTTCAGCTTTGTAC21466
113085217519435263545AGTGGCAGGGCTCCCCGGTG59467
113087121623535673586GGTACATTTGTGGTACAGCT16183
113088122924835803599GCCGGCCCTTGTGGGTACAT52468
113090929431338013820ACAGTATCCCCATCGCTGGT46469
113093733435341424161TGTGTTTGCTGCAGTGGTCT63470
113096540742642154234GTGAGGTGTTGTGGACAGAG40471
113099345046943954414AAGCTGAGGCTCAAAGCACT37472
113102149551444404459TTGCTCAGTTCTATACCATA16473
113104953655544814500TGGGCATCAGGACCCTTGCA47474
1131077570589N/AN/AGGTGCGGCAGGCCTGGCTGG52475
113110561062946944713CCTCCACCTCTAGGCAGCGA48476
113113365667547404759CAGAAGGCTCCGGTGTAGCC89477
113116171273149414960GGCCGCGGTAGCTGAGCCCG59478
113118976678549955014TGGCCTCCGAGGCCCACGGC75479
1131217844863N/AN/ACGTTGTCCGGGTTCCGGCAG32480
113124590592452195238AGGTCGCAGTACTCCCAGCT37481
1131273997101653115330GCGGTGCCGGCTGCGCGGGC49482
11313011075109454945513GCGGCTGCTCCCGCTTCGCC48483
11313291120113955395558GGAGCCGCTGCCCGCAGCTC51484
11313571156117555755594CGCCAACGACGCGGGTCATC23485
11313851228124756475666TGCCGGCGCAGAAACTGTGG61486
11314131314133359745993GCCGAGCACCACCGTCAGAT35487
11314411400141960606079CTGACGGGCGAGAAGGCCTC37488
11314691463148262066225AGGAGCGCGCAGCTGCCGTC77464
11314971551157062946313GTGGCCCCAGCCGGCCACCT114 489
11315251582160168806899AGCTGGCATATTCCTCCGCC113 490
11315531623164269216940GCGCTCCAGGGAGAGGAACG90491
11315811749176871377156AGCTTGGTCCTCACACACCA  7492
11316091796181571847203CCCGATCCCCAGCTGATGAT33493
11316371843186272317250AGTAGGCCACATCGGTGTAG37494
11316651874189372627281GAAACGGTGTGCTCCCGGAT36495
11316931918193773067325TGCGGAATCACCAAGGAGGG11496
11317211954197373427361ACAATCTTGCCTTCCATGCC25497
11317492009202873977416TATTGAGTTCCTGCGCCATC13498
1131777N/AN/A103122TTCCCACAGCACTCACCGAA77499
1131805N/AN/A187206CACCTGGACCCACAGGTCAT88500
1131833N/AN/A283302TGCAGGCTGTGCCCTTGTAT115 501
1131861N/AN/A377396CTCTCACAGCCCAGAAATGC73502
1131889N/AN/A466485CCAAGGTGGAATCTACAAGG30503
1131917N/AN/A612631CACCAGGTAGGCACTAGACT42504
1131945N/AN/A716735CCTGCTCCGAGCCAGGCTCG62505
1131973N/AN/A868887TCCTTGCCCATTGAAGGCCC43506
1132001N/AN/A966985TTGGAGAACTCAAATCCCTC52507
1132029N/AN/A10731092TCCATGCACCAGGTGATGGG54508
1132057N/AN/A12061225CATGTAGGTAATTTAGTGTC47509
1132085N/AN/A15841603GAGACTCAACCCCACCAAGT60510
1132113N/AN/A17561775CAGATGGGATGGACGGACAG74511
1132141N/AN/A21322151CACTTGCCAAGGACCAAACC69512
1132169N/AN/A22622281AATTGCCTGTGTCTTCTTCA51513
1132197N/AN/A23762395ATATGCTGTTGGTTGATGAA48514
1132225N/AN/A24882507TAGACACTTGATTCAGGTGT43515
1132253N/AN/A26372656GTGTCCTTCTCAGTCTACTT45516
1132281N/AN/A27452764TGGCCATTTGTGGGCATGCA69517
1132309N/AN/A28412860CAGTTGATCCTCATTCTTCT57518
1132337N/AN/A29532972CACTTGCCACAAAGTAGGCA44519
1132365N/AN/A30513070TTGGGTTCAGGAGTCAGATA73520
1132393N/AN/A34453464GCACTGTCCCTCAGGGTCTG47521
1132421N/AN/A36433662GTACATGTCTCCCAGGCCCC50522
1132449N/AN/A37553774CACCTGTAGAAAGAGACAAG58523
1132477N/AN/A38983917GGGTCTGGTGATACCAGGAG44524
1132505N/AN/A40244043CAAGTTTCCAAGCTTGGTTT29525
1132533N/AN/A41314150CAGTGGTCTGAGAGATGGAC46526
1132561N/AN/A43194338TCCGAGTATCCAGCAACCTA50527
1132589N/AN/A45574576CCAGCCTGTCTTCCTGACGC67528
1132617N/AN/A46574676GTTGGTGCGGCAGGCTTGGG59529
1132645N/AN/A48694888GCAGCCAAGGCTGGGCTCTC59530
1132673N/AN/A53925411GGCTCCTCCTTCCCCCCCCC41531
1132701N/AN/A57605779CTGCGCTGGGAGACGGAGGA70532
1132729N/AN/A61676186AACAGAGCTAACCCGGGCGG65533
1132757N/AN/A63826401AAAGTCGCGGGCTTCTTCCG31534
1132785N/AN/A64906509TCCCAGCAGTGAATCCCAGG69535
1132813N/AN/A66306649ACCCATCCAGAGTCGCAGAA43536
1132841N/AN/A67216740ATTAATTCAATTTCATAGGC68537
1132869N/AN/A68626881CCCCTGCGAACACAGAGCGC59538
TABLE 39
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
11307978310283102AGTGTTGACTCCAAGCTCAC27541
1130825141160508527TGTGTGCTCTTCAGCTTTGT14542
113085317719635283547GAAGTGGCAGGGCTCCCCGG33543
113087121623535673586GGTACATTTGTGGTACAGCT 9183
113088223125035823601TGGCCGGCCCTTGTGGGTAC23544
113091029631538033822AAACAGTATCCCCATCGCTG36545
113093833535441434162CTGTGTTTGCTGCAGTGGTC13546
113096640842742164235AGTGAGGTGTTGTGGACAGA48547
113099445147043964415GAAGCTGAGGCTCAAAGCAC22548
113102249651544414460CTTGCTCAGTTCTATACCAT23549
113105053755644824501GTGGGCATCAGGACCCTTGC41550
1131078571590N/AN/ATGGTGCGGCAGGCCTGGCTG33551
113110661263146964715GCCCTCCACCTCTAGGCAGC26552
113113465767647414760GCAGAAGGCTCCGGTGTAGC23553
113116271473349434962CAGGCCGCGGTAGCTGAGCC34554
113119076778649965015GTGGCCTCCGAGGCCCACGG50555
113121886288151765195AGCACCACGGGCGGATGTCG25539
113124690792652215240CCAGGTCGCAGTACTCCCAG26556
1131274998101753125331GGCGGTGCCGGCTGCGCGGG71557
11313021076109554955514GGCGGCTGCTCCCGCTTCGC20558
11313301121114055405559CGGAGCCGCTGCCCGCAGCT33559
11313581158117755775596CCCGCCAACGACGCGGGTCA19560
11313861229124856485667CTGCCGGCGCAGAAACTGTG46561
11314141315133459755994GGCCGAGCACCACCGTCAGA32562
11314421401142060616080GCTGACGGGCGAGAAGGCCT19563
11314701464148362076226CAGGAGCGCGCAGCTGCCGT33564
11314981552157162956314GGTGGCCCCAGCCGGCCACC46565
11315261583160268816900AAGCTGGCATATTCCTCCGC136 566
11315541657167669556974GGATGGAGGATCCGTGCACG 15567
11315821750176971387157CAGCTTGGTCCTCACACACC 11568
11316101797181671857204GCCCGATCCCCAGCTGATGA39569
11316381844186372327251TAGTAGGCCACATCGGTGTA2587
11316661876189572647283AGGAAACGGTGTGCTCCCGG31570
11316941919193873077326CTGCGGAATCACCAAGGAGG10571
11317221955197473437362CACAATCTTGCCTTCCATGC18572
11317502010202973987417TTATTGAGTTCCTGCGCCAT23573
1131778N/AN/A106125TGGTTCCCACAGCACTCACC42574
1131806N/AN/A190209AGTCACCTGGACCCACAGGT28575
1131834N/AN/A286305AAATGCAGGCTGTGCCCTTG33576
1131862N/AN/A380399TTCCTCTCACAGCCCAGAAA41577
1131890N/AN/A469488TTCCCAAGGTGGAATCTACA74578
1131918N/AN/A615634TAGCACCAGGTAGGCACTAG45579
1131946N/AN/A721740AAGCACCTGCTCCGAGCCAG33580
1131974N/AN/A871890CCTTCCTTGCCCATTGAAGG46581
1132002N/AN/A969988AGCTTGGAGAACTCAAATCC56582
1132030N/AN/A10761095ATTTCCATGCACCAGGTGAT58583
1132058N/AN/A12091228TGGCATGTAGGTAATTTAGT34584
1132086N/AN/A15871606TTAGAGACTCAACCCCACCA55585
1132114N/AN/A17591778ATGCAGATGGGATGGACGGA48586
1132142N/AN/A21352154GTGCACTTGCCAAGGACCAA25587
1132170N/AN/A22652284GAGAATTGCCTGTGTCTTCT40588
1132198N/AN/A23792398ATTATATGCTGTTGGTTGAT28589
1132226N/AN/A25132532GCTACCTTAGGGAGAAAGCG53590
1132254N/AN/A26402659TGAGTGTCCTTCTCAGTCTA47591
1132282N/AN/A27482767TCATGGCCATTTGTGGGCAT46592
1132310N/AN/A28452864AGTACAGTTGATCCTCATTC56593
1132338N/AN/A29562975GAGCACTTGCCACAAAGTAG30594
1132366N/AN/A30543073AACTTGGGTTCAGGAGTCAG42595
1132394N/AN/A34483467CAGGCACTGTCCCTCAGGGT32596
1132422N/AN/A36493668GGCAGGGTACATGTCTCCCA36597
1132450N/AN/A37583777GCACACCTGTAGAAAGAGAC39598
1132478N/AN/A39163935CAGAATCCCAGGTGTGTGGG64599
1132506N/AN/A40274046CTCCAAGTTTCCAAGCTTGG38600
1132534N/AN/A41344153CTGCAGTGGTCTGAGAGATG36601
1132562N/AN/A43254344CAAGTCTCCGAGTATCCAGC49602
1132590N/AN/A45604579CTGCCAGCCTGTCTTCCTGA30603
1132618N/AN/A46604679CGGGTTGGTGCGGCAGGCTT30604
1132646N/AN/A48754894CCCTGGGCAGCCAAGGCTGG53605
1132674N/AN/A53955414CTCGGCTCCTCCTTCCCCCC45606
1132702N/AN/A57635782AAGCTGCGCTGGGAGACGGA45607
1132730N/AN/A61706189CGCAACAGAGCTAACCCGGG45608
1132758N/AN/A63856404ACCAAAGTCGCGGGCTTCTT43609
1132786N/AN/A64936512GGATCCCAGCAGTGAATCCC59610
1132814N/AN/A66336652ACCACCCATCCAGAGTCGCA44611
1132842N/AN/A67246743GCCATTAATTCAATTTCATA45612
1132870N/AN/A68656884CCGCCCCTGCGAACACAGAG44613
TABLE 40
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 2000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113086821323235643583ACATTTGTGGTACAGCTGCC841756
1130987443462N/AN/AGGCTCAAAGCACTTCTCTTT932135
11315931780179971687187TGATGCCTTGCAGGGTGAGC371326
11316941919193873077326CTGCGGAATCACCAAGGAGG57571
11317011928194773167335ACTCTCTCACTGCGGAATCA421179
11317462005202473937412GAGTTCCTGCGCCATCCTGG40159
11317542015203474037422GCACTTTATTGAGTTCCTGC35164
11317562017203674057424AAGCACTTTATTGAGTTCCT111030
11317572018203774067425AAAGCACTTTATTGAGTTCC36165
11317632026204574147433GCATTTTCAAAGCACTTTAT411562
1131891N/AN/A513532CCGACTGTGTGCTCTTCAGC88659
1132188N/AN/A23232342ACTGTTTGCTAGTTCAATGT1061951
1132271N/AN/A27062725CACATTCCCAGTTAAGGTTC931879
1132505N/AN/A40244043CAAGTTTCCAAGCTTGGTTT104525
1132651N/AN/A49084927AGCTTGCCTTGGTGTCTGAG79985
1132797N/AN/A65426561AGGGAACCAAGAGCAAGTTC721369
1194299N/AN/A23182337TTGCTAGTTCAATGTTCACT952351
1194300N/AN/A23192338TTTGCTAGTTCAATGTTCAC672352
1194301N/AN/A23212340TGTTTGCTAGTTCAATGTTC1022353
1194302N/AN/A23222341CTGTTTGCTAGTTCAATGTT972354
1194303N/AN/A23242343TACTGTTTGCTAGTTCAATG952355
1194304N/AN/A23252344ATACTGTTTGCTAGTTCAAT972356
1194305N/AN/A23272346TAATACTGTTTGCTAGTTCA962357
1194306N/AN/A23282347CTAATACTGTTTGCTAGTTC932358
1194307N/AN/A27012720TCCCAGTTAAGGTTCAACAA992359
1194308N/AN/A27022721TTCCCAGTTAAGGTTCAACA962360
1194309N/AN/A27042723CATTCCCAGTTAAGGTTCAA792361
1194310N/AN/A27052724ACATTCCCAGTTAAGGTTCA812362
1194311N/AN/A27072726GCACATTCCCAGTTAAGGTT1002363
1194312N/AN/A27082727TGCACATTCCCAGTTAAGGT952364
1194313N/AN/A27102729TTTGCACATTCCCAGTTAAG922365
1194314N/AN/A27112730ATTTGCACATTCCCAGTTAA1052366
1194315N/AN/A40194038TTCCAAGCTTGGTTTACCCA1132367
1194316N/AN/A40204039TTTCCAAGCTTGGTTTACCC1092368
1194317N/AN/A40224041AGTTTCCAAGCTTGGTTTAC872369
1194318N/AN/A40234042AAGTTTCCAAGCTTGGTTTA842370
1194319N/AN/A40254044CCAAGTTTCCAAGCTTGGTT1022371
1194320N/AN/A40264045TCCAAGTTTCCAAGCTTGGT812372
1194321N/AN/A40284047ACTCCAAGTTTCCAAGCTTG952373
1194322N/AN/A40294048TACTCCAAGTTTCCAAGCTT982374
1194323N/AN/A49034922GCCTTGGTGTCTGAGGAGAA832375
1194324N/AN/A49044923TGCCTTGGTGTCTGAGGAGA802376
1194325N/AN/A49064925CTTGCCTTGGTGTCTGAGGA752377
1194326N/AN/A49074926GCTTGCCTTGGTGTCTGAGG772378
1194327N/AN/A49094928CAGCTTGCCTTGGTGTCTGA782379
1194328N/AN/A49104929GCAGCTTGCCTTGGTGTCTG872380
119432968370249124931TAGCAGCTTGCCTTGGTGTC992381
119433068470349134932ATAGCAGCTTGCCTTGGTGT932382
1194331N/AN/A65376556ACCAAGAGCAAGTTCGATTC602383
1194332N/AN/A65386557AACCAAGAGCAAGTTCGATT562384
1194333N/AN/A65406559GGAACCAAGAGCAAGTTCGA732385
1194334N/AN/A65416560GGGAACCAAGAGCAAGTTCG692386
1194335N/AN/A65436562GAGGGAACCAAGAGCAAGTT742387
1194336N/AN/A65446563AGAGGGAACCAAGAGCAAGT692388
1194337N/AN/A65456564CAGAGGGAACCAAGAGCAAG852389
1194338N/AN/A65466565CCAGAGGGAACCAAGAGCAA682390
1194339N/AN/A65476566CCCAGAGGGAACCAAGAGCA572391
1206452143162510529ACTGTGTGCTCTTCAGCTTT78175
120645320922835603579TTGTGGTACAGCTGCCGGTG792392
12064541912193173007319ATCACCAAGGAGGGAAAGAT532393
12064551920193973087327ACTGCGGAATCACCAAGGAG392394
12064561925194473137332CTCTCACTGCGGAATCACCA282395
12064571929194873177336CACTCTCTCACTGCGGAATC172396
12064581931195073197338GCCACTCTCTCACTGCGGAA252397
12064591934195373227341CCAGCCACTCTCTCACTGCG422398
1206460N/AN/A514533ACCGACTGTGTGCTCTTCAG822399
1206461N/AN/A515534TACCGACTGTGTGCTCTTCA902400
1206462N/AN/A517536CTTACCGACTGTGTGCTCTT1022401
1206463N/AN/A518537ACTTACCGACTGTGTGCTCT682402
1206464N/AN/A23132332AGTTCAATGTTCACTGTGAT1052403
1206465N/AN/A23332352GGAACCTAATACTGTTTGCT922404
1206466N/AN/A26962715GTTAAGGTTCAACAAGGCGT812405
1206467N/AN/A27162735GAAAAATTTGCACATTCCCA922406
1206468N/AN/A40144033AGCTTGGTTTACCCACCTGC952407
1206469N/AN/A40344053CTTGCTACTCCAAGTTTCCA802408
1206470N/AN/A48984917GGTGTCTGAGGAGAAAGGGG822409
1206471N/AN/A65326551GAGCAAGTTCGATTCTCCCT672410
1206472N/AN/A65526571CGGCGCCCAGAGGGAACCAA952411
TABLE 41
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 3NO: 3NO: 4NO: 4SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1131768N/AN/A20332052TTTCTCAGCATTTTCAAAGC352412
1131767108431086220312050TCTCAGCATTTTCAAAGCAC252413
1131770N/AN/A20362055TTTTTTCTCAGCATTTTCAA542414
1131771N/AN/A20372056TTTTTTTCTCAGCATTTTCA832415
1130767345834773453TCATGGCATCCGTCCGTTGG36617
1130768345934783554CTCATGGCATCCGTCCGTTG90619
11328971084610865N/AN/ACCTTCTCAGCATTTTCAAAG62618
1130769346034793655CCTCATGGCATCCGTCCGTT22540
11328981084910868N/AN/ATTTCCTTCTCAGCATTTTCA61616
TABLE 42
Reduction of FXII RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
(Huh7, electroporation, 5000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 3NO: 3NO: 4NO: 4SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
113074434283447423TATCCAGGAGTCCAGATCAA612416
1130772346334823958AGCCCTCATGGCATCCGTCC352417
1130755344334621938GTTGGTCCAGCTGCCTATCC642418
1130756344434632039CGTTGGTCCAGCTGCCTATC502419
1130760345034692645TCCGTCCGTTGGTCCAGCTG372420
1130765345634753251ATGGCATCCGTCCGTTGGTC43238
1130766345734763352CATGGCATCCGTCCGTTGGT50314

Modified oligonucleotides complementary to an FXII nucleic acid were synthesized and tested for their effect on FXII RNA levels in vitro. The modified oligonucleotides were tested in a series of experiments using similar culture conditions. The results for each separate experiment are presented in separate tables below.

The modified oligonucleotides in the tables below are 3-10-3 cEt gapmers (i.e., they have a central region of ten 2′-deoxynucleosides flanked on each side by wings, each comprising three cEt modified nucleosides). The internucleoside linkages throughout each modified oligonucleotide are phosphorothioate (P═S) linkages. All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. “Stop site” indicates the 3′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are 100% complementary to one or more of human FXII target sequences including the human FXII mRNA sequence designated herein as SEQ ID NO: 1 (ENSEMBL ID ENST00000253496.3 from ENSEMBL version 99: January 2020), the human FXII genomic sequence, designated herein as SEQ ID NO: 2 (ENSEMBL ID ENSG00000131187.9 from ENSEML version 99: January 2020), the human FXII genomic sequence, designated herein as SEQ ID No. 3 (the complement of GENBANK Accession No. NC_000005.10 truncated from truncated from nucleotides 177399001 to 177413000), and the human FXII mRNA sequence designated herein as SEQ ID No: 4 (GENBANK Accession No. NM 000505.3) ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular target sequence with 100% complementarity.

Cultured Huh7 cells, at a density of 20,000 cells per well, were transfected using electroporation with either 2000 nM or 3000 nM modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and FXII RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS40528 (described herein above) was used to measure RNA levels. FXII RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of FXII RNA is presented in the tables below as percent FXII RNA relative to the amount in untreated control cells (% UTC). The symbol “” indicates that the modified oligonucleotide is complementary to the target transcript within the amplicon region of the primer probe set. In such instances, additional assays using alternative primer probes must be performed to accurately assess the potency and efficacy of such modified oligonucleotides.

TABLE 43
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1128712318318AGGAGTCCAGATCAAT502421
112873280958095ACTCCAAGCTCACCAG372422
1128752125140492507ACTTATGCTCCTTGGG392423
1128772156171N/AN/AGTGAGAACGACTGTGT392424
112879220021535513566GCCGGTGGTACTGGAA572425
112880221823335693584TACATTTGTGGTACAG122426
112881323124635823597CGGCCCTTGTGGGTAC792427
112883329430938013816TATCCCCATCGCTGGT512428
112885340942442174232GAGGTGTTGTGGACAG452429
112887348249744274442ATATCTCATTCTTGTG222430
112889354556044904505GGCAGTGGGCATCAGG402431
112891359861346824697GCGACCCCCATGGAGG392432
112893363464947184733GCAGTGGCACAGGCGG362433
112895366467947484763GTCGCAGAAGGCTCCG642434
112897371372849424957CGCGGTAGCTGAGCCC682435
112899375977449885003GCCCACGGCTGACAGG622436
112901380782250365051CAGTTCCGCGCTTGCT602437
112903386387851775192ACCACGGGCGGATGTC542438
112905389290752065221GCTCAGCCGGTCGCGG512439
112907398299752965311CATGAGTGGGACATGA452440
11290931043105853575372TCTGGGACTGAGGCGG332441
11291131089110455085523GTCAGGGAAGGCGGCT382442
11291331129114455485563CTTGCGGAGCCGCTGC372443
11291531152116755715586ACGCGGGTCATCGAAG532444
11291731209122456285643CAGTACAGCGCGGCGA352445
11291931240125556595674GATGAGGCTGCCGGCG812446
11292131319133459795994GGCCGAGCACCACCGT442447
11292331384139960446059GTGCAAGCGGTAGGAG762448
11292531438145361816196CTGAAGGCGCAACAGA612449
11292731463147862066221GCGCGCAGCTGCCGTC392450
11292931497151262406255GGCAGGCACACCGGCT932451
11293131558157363016316CTGGTGGCCCCAGCCG962452
11293331580159568786893CATATTCCTCCGCCCC782453
11293531619163469176932GGGAGAGGAACGGTAC126 2454
11293731693170869917006CTCGAGGAACCCTGCG 272455
11293931748176371367151GGTCCTCACACACCAG 442456
11294131798181371867201CGATCCCCAGCTGATG272457
11294331839185472277242ACATCGGTGTAGACGC282458
11294531866188172547269TCCCGGATCCAGGCCA412459
11294731898191372867301ATGAGTCCCTGAGCAA262460
11294931931194673197334CTCTCTCACTGCGGAA152461
11295131990200573787393GCGCGGAGCTGGCCGC462462
11295332011202673997414TTGAGTTCCTGCGCCA232463
1129553N/AN/A97112ACTCACCGAAAGTGTT782464
1129573N/AN/A197212CCTAGTCACCTGGACC632465
1129593N/AN/A328343CCTCCCCCCGTTGTCT492466
1129613N/AN/A434449GAACTGACTATAAGTC612467
1129633N/AN/A606621GCACTAGACTAGACTG542468
1129653N/AN/A652667CACGATCACTCTAGTG512469
1129673N/AN/A908923GAGGCATTCAGATGCC612470
1129693N/AN/A10551070GAATACCTCACATGGG862471
1129713N/AN/A15571572GGGTAAGGTCCATCTG612472
1129733N/AN/A17091724CAAGGATAGGGCACCA502473
1129753N/AN/A21462161AGGCAAAGTGCACTTG552474
1129773N/AN/A24502465GCATTGATGAATCAGC472475
1129793N/AN/A25272542GCACAAGAAGGCTACC542476
1129813N/AN/A28522867AATAGTACAGTTGATC542477
1129833N/AN/A30483063CAGGAGTCAGATAGCT642478
1129853N/AN/A36523667GCAGGGTACATGTCTC682479
1129873N/AN/A40154030TTGGTTTACCCACCTG732480
1129893N/AN/A43164331ATCCAGCAACCTATTC672481
1129913N/AN/A43604375ATAGTGGTCTCAGGAG642482
1129933N/AN/A46194634CTGGGCCTAAAGACCC622483
1129953N/AN/A50705085GGCGCACCGGCAGAAG522484
1129973N/AN/A54185433CTAGCTCGCCCGGCGC762485
1129993N/AN/A54505465GGACGGAGAGCCCGCG742486
1130013N/AN/A57555770GAGACGGAGGAGCCGC542487
1130033N/AN/A58695884ACCCCAATCCCGTGTT612488
1130053N/AN/A61706185ACAGAGCTAACCCGGG962489
1130073N/AN/A63306345TGCCCCTAGCAGTTGT652490
1130093N/AN/A63896404ACCAAAGTCGCGGGCT137 2491
1130113N/AN/A64136428CATTCTGTAGGCACCC832492
1130133N/AN/A65386553AAGAGCAAGTTCGATT512493
1130153N/AN/A66246639AGTCGCAGAACCTGGC492494
1130173N/AN/A66766691GATTTGAATGGGCGGA552495
1130193N/AN/A68126827CGGACGATGGACAAAG642496
1130213N/AN/A68766891TATTCCTCCGCCCCTG131 2497
1130233N/AN/A70787093CGCTGTGGACCTGAGA 892498
TABLE 44
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1128713419419CAGGAGTCCAGATCAA352499
112873381968196GACTCCAAGCTCACCA382500
1128753126141493508TACTTATGCTCCTTGG352501
1128773157172N/AN/AAGTGAGAACGACTGTG312502
112879320121635523567TGCCGGTGGTACTGGA412503
112880221823335693584TACATTTGTGGTACAG182426
112881423324835843599GCCGGCCCTTGTGGGT552504
112883429531038023817GTATCCCCATCGCTGG352505
112885441142642194234GTGAGGTGTTGTGGAC382506
112887448449944294444CCATATCTCATTCTTG242507
112889455156644964511GCCGCTGGCAGTGGGC512508
112891459961446834698AGCGACCCCCATGGAG372509
112893463965447234738ACCGGGCAGTGGCACA462510
112895466568047494764CGTCGCAGAAGGCTCC452511
112897471472949434958CCGCGGTAGCTGAGCC902512
112899476177649905005AGGCCCACGGCTGACA442513
112901480882350375052CCAGTTCCGCGCTTGC332514
112903486487951785193CACCACGGGCGGATGT562515
112905489691152105225CCCAGCTCAGCCGGTC572516
1129074989100453035318GCGCGGGCATGAGTGG372517
11290941044105953585373GTCTGGGACTGAGGCG262518
11291141090110555095524GGTCAGGGAAGGCGGC212519
11291341130114555495564TCTTGCGGAGCCGCTG382520
11291541153116855725587GACGCGGGTCATCGAA472521
11291741210122556295644CCAGTACAGCGCGGCG272522
11291941241125656605675CGATGAGGCTGCCGGC532523
11292141320133559805995TGGCCGAGCACCACCG382524
11292341385140060456060CGTGCAAGCGGTAGGA382525
11292541439145461826197CCTGAAGGCGCAACAG372526
11292741464147962076222AGCGCGCAGCTGCCGT302527
11292941498151362416256TGGCAGGCACACCGGC202528
11293141559157463026317ACTGGTGGCCCCAGCC732529
11293341581159668796894GCATATTCCTCCGCCC832530
11293541620163569186933AGGGAGAGGAACGGTA692531
11293741694170969927007CCTCGAGGAACCCTGC 182532
11293941749176471377152TGGTCCTCACACACCA 412533
11294141800181571887203CCCGATCCCCAGCTGA472534
11294341840185572287243CACATCGGTGTAGACG342535
11294541867188272557270CTCCCGGATCCAGGCC472536
11294741899191472877302GATGAGTCCCTGAGCA272537
11294941946196173347349TCCATGCCCCAGCCAC252538
11295141991200673797394GGCGCGGAGCTGGCCG772539
11295342012202774007415ATTGAGTTCCTGCGCC152540
1129554N/AN/A99114GCACTCACCGAAAGTG782541
1129574N/AN/A198213TCCTAGTCACCTGGAC532542
1129594N/AN/A329344ACCTCCCCCCGTTGTC622543
1129614N/AN/A435450GGAACTGACTATAAGT532544
1129634N/AN/A607622GGCACTAGACTAGACT642545
1129654N/AN/A653668TCACGATCACTCTAGT412546
1129674N/AN/A953968CTCGCCCAGAGTCACC722547
1129694N/AN/A10561071TGAATACCTCACATGG482548
1129714N/AN/A15581573AGGGTAAGGTCCATCT352549
1129734N/AN/A17101725GCAAGGATAGGGCACC572550
1129754N/AN/A22502265TTCAGAGGAATTGTCG522551
1129774N/AN/A24522467TAGCATTGATGAATCA722552
1129794N/AN/A25402555GTGTAGTTCCTAAGCA572553
1129814N/AN/A28622877CGGCAGTAATAATAGT772554
1129834N/AN/A33733388TCTAAAAGTTGGGTTC512555
1129854N/AN/A37043719GCCCTATCACAGTCCC532556
1129874N/AN/A40174032GCTTGGTTTACCCACC702557
1129894N/AN/A43184333GTATCCAGCAACCTAT482558
1129914N/AN/A43614376GATAGTGGTCTCAGGA582559
1129934N/AN/A46204635CCTGGGCCTAAAGACC852560
1129954N/AN/A50715086CGGCGCACCGGCAGAA422561
1129974N/AN/A54195434TCTAGCTCGCCCGGCG612562
1129994N/AN/A54515466AGGACGGAGAGCCCGC492563
1130014N/AN/A57625777GCGCTGGGAGACGGAG101 2564
1130034N/AN/A58705885AACCCCAATCCCGTGT542565
1130054N/AN/A61716186AACAGAGCTAACCCGG622566
1130074N/AN/A63316346CTGCCCCTAGCAGTTG118 2567
1130094N/AN/A63906405TACCAAAGTCGCGGGC462568
1130114N/AN/A64206435CGCCACCCATTCTGTA542569
1130134N/AN/A65396554CAAGAGCAAGTTCGAT692570
1130154N/AN/A66266641AGAGTCGCAGAACCTG512571
1130174N/AN/A66776692GGATTTGAATGGGCGG482572
1130194N/AN/A68136828CCGGACGATGGACAAA562573
1130214N/AN/A68776892ATATTCCTCCGCCCCT782574
1130234N/AN/A70917106ACACGCAGCTCAGCGC 562575
TABLE 45
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1128714621621TCCAGGAGTCCAGATC852576
112873482978297TGACTCCAAGCTCACC302577
1128754127142494509GTACTTATGCTCCTTG162578
1128774158173N/AN/ACAGTGAGAACGACTGT362579
112879420221735533568CTGCCGGTGGTACTGG222580
112880221823335693584TACATTTGTGGTACAG122426
112881523525035863601TGGCCGGCCCTTGTGG572581
112883529731238043819CAGTATCCCCATCGCT162582
112885541242742204235AGTGAGGTGTTGTGGA382583
112887548750244324447ATACCATATCTCATTC182584
112889555256744974512AGCCGCTGGCAGTGGG492585
112891560061546844699CAGCGACCCCCATGGA302586
112893564065547244739CACCGGGCAGTGGCAC322587
1128955679694N/AN/ATGCCTTGGTGTCCACG312588
112897571573049444959GCCGCGGTAGCTGAGC522589
112899576277749915006GAGGCCCACGGCTGAC312590
112901580982450385053CCCAGTTCCGCGCTTG182591
112903586688151805195AGCACCACGGGCGGAT262592
112905589791252115226TCCCAGCTCAGCCGGT272593
1129075990100553045319TGCGCGGGCATGAGTG242594
112909510601075N/AN/ACGGCAAGGCTCCCGGG352595
11291151099111455185533GCCGTTCCTGGTCAGG252596
11291351131114655505565CTCTTGCGGAGCCGCT222597
11291551154116955735588CGACGCGGGTCATCGA582598
11291751211122656305645CCCAGTACAGCGCGGC222599
11291951242125756615676GCGATGAGGCTGCCGG302600
11292151321133659815996CTGGCCGAGCACCACC232601
11292351399141460596074GGGCGAGAAGGCCTCG602602
11292551440145561836198TCCTGAAGGCGCAACA222603
11292751465148062086223GAGCGCGCAGCTGCCG182604
11292951499151462426257TTGGCAGGCACACCGG202605
11293151560157563036318AACTGGTGGCCCCAGC382606
11293351582159768806895GGCATATTCCTCCGCC422607
11293551621163669196934CAGGGAGAGGAACGGT432608
11293751695171069937008CCCTCGAGGAACCCTG  92609
11293951750176571387153TTGGTCCTCACACACC 242610
11294151801181671897204GCCCGATCCCCAGCTG332611
11294351841185672297244CCACATCGGTGTAGAC202612
11294551868188372567271GCTCCCGGATCCAGGC342613
11294751900191572887303AGATGAGTCCCTGAGC102614
11294951947196273357350TTCCATGCCCCAGCCA202615
11295151992200773807395TGGCGCGGAGCTGGCC492616
11295352013202874017416TATTGAGTTCCTGCGC 82617
1129555N/AN/A100115AGCACTCACCGAAAGT105 2618
1129575N/AN/A199214CTCCTAGTCACCTGGA802619
1129595N/AN/A332347TCTACCTCCCCCCGTT117 2620
1129615N/AN/A436451GGGAACTGACTATAAG153 2621
1129635N/AN/A608623AGGCACTAGACTAGAC622622
1129655N/AN/A654669CTCACGATCACTCTAG562623
1129675N/AN/A955970CCCTCGCCCAGAGTCA582624
1129695N/AN/A10591074GGCTGAATACCTCACA362625
1129715N/AN/A15591574CAGGGTAAGGTCCATC332626
1129735N/AN/A17111726GGCAAGGATAGGGCAC502627
1129755N/AN/A22792294CGCGAATAATGAGAAT642628
1129775N/AN/A24572472CAGCTTAGCATTGATG522629
1129795N/AN/A25432558GCTGTGTAGTTCCTAA562630
1129815N/AN/A28632878ACGGCAGTAATAATAG492631
1129835N/AN/A33753390GCTCTAAAAGTTGGGT602632
1129855N/AN/A37643779TAGCACACCTGTAGAA832633
1129875N/AN/A40184033AGCTTGGTTTACCCAC422634
1129895N/AN/A43204335GAGTATCCAGCAACCT492635
1129915N/AN/A43624377GGATAGTGGTCTCAGG652636
1129935N/AN/A46224637CCCCTGGGCCTAAAGA722637
1129955N/AN/A50725087GCGGCGCACCGGCAGA552638
1129975N/AN/A54205435ATCTAGCTCGCCCGGC372639
1129995N/AN/A54525467GAGGACGGAGAGCCCG882640
1130015N/AN/A57635778TGCGCTGGGAGACGGA732641
1130035N/AN/A58715886GAACCCCAATCCCGTG492642
1130055N/AN/A61726187CAACAGAGCTAACCCG592643
1130075N/AN/A63556370GATCAAAGGTCTCCTC412644
1130095N/AN/A63916406ATACCAAAGTCGCGGG802645
1130115N/AN/A64346449ACCCATCAGGTCAGCG592646
1130135N/AN/A65406555CCAAGAGCAAGTTCGA472647
1130155N/AN/A66276642CAGAGTCGCAGAACCT482648
1130175N/AN/A66786693AGGATTTGAATGGGCG382649
1130195N/AN/A68146829CCCGGACGATGGACAA682650
1130215N/AN/A70157030CACCTGGCACGCATCG 242651
1130235N/AN/A70937108AAACACGCAGCTCAGC 812652
TABLE 46
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1128715924924CTATCCAGGAGTCCAG702653
11287358710287102AGTGTTGACTCCAAGC222654
1128755128143495510TGTACTTATGCTCCTT232655
1128775159174N/AN/AACAGTGAGAACGACTG482656
112879521022535613576TGGTACAGCTGCCGGT172657
112880221823335693584TACATTTGTGGTACAG 82426
112881623625135873602CTGGCCGGCCCTTGTG352658
112883629831338053820ACAGTATCCCCATCGC162659
112885641342842214236CAGTGAGGTGTTGTGG342660
112887648950444344449CTATACCATATCTCAT202661
112889655657145014516GGCCAGCCGCTGGCAG742662
112891660161646854700GCAGCGACCCCCATGG192663
112893664165647254740CCACCGGGCAGTGGCA282664
112895668369849124927AGCTTGCCTTGGTGTC222665
112897671673149454960GGCCGCGGTAGCTGAG622666
112899676578049945009TCCGAGGCCCACGGCT302667
112901681082550395054CCCCAGTTCCGCGCTT362668
112903686788251815196AAGCACCACGGGCGGA252669
112905690592052195234CGCAGTACTCCCAGCT202670
1129076991100653055320CTGCGCGGGCATGAGT232671
112909610611076N/AN/ACCGGCAAGGCTCCCGG662672
11291161102111755215536TGGGCCGTTCCTGGTC312673
11291361132114755515566ACTCTTGCGGAGCCGC162674
11291561156117155755590AACGACGCGGGTCATC542675
11291761212122756315646CCCCAGTACAGCGCGG412676
11291961243125856625677GGCGATGAGGCTGCCG792677
11292161323133859835998TCCTGGCCGAGCACCA322678
11292361400141560606075CGGGCGAGAAGGCCTC462679
11292561441145661846199CTCCTGAAGGCGCAAC342680
11292761467148262106225AGGAGCGCGCAGCTGC182681
11292961502151762456260CGCTTGGCAGGCACAC292682
11293161561157663046319GAACTGGTGGCCCCAG322683
11293361583159868816896TGGCATATTCCTCCGC372684
11293561657167269556970GGAGGATCCGTGCACG  32685
11293761696171169947009GCCCTCGAGGAACCCT 112686
11293961751176671397154CTTGGTCCTCACACAC  92687
11294161802181771907205AGCCCGATCCCCAGCT362688
11294361842185772307245GCCACATCGGTGTAGA232689
11294561876189172647279AACGGTGTGCTCCCGG172690
11294761901191672897304AAGATGAGTCCCTGAG 72691
11294961948196373367351CTTCCATGCCCCAGCC162692
11295161993200873817396CTGGCGCGGAGCTGGC122693
11295362014202974027417TTATTGAGTTCCTGCG102694
1129556N/AN/A101116CAGCACTCACCGAAAG552695
1129576N/AN/A204219TAGGCCTCCTAGTCAC572696
1129596N/AN/A333348TTCTACCTCCCCCCGT922697
1129616N/AN/A439454GCAGGGAACTGACTAT143 2698
1129636N/AN/A610625GTAGGCACTAGACTAG522699
1129656N/AN/A655670GCTCACGATCACTCTA332700
1129676N/AN/A957972ATCCCTCGCCCAGAGT662701
1129696N/AN/A10611076TGGGCTGAATACCTCA522702
1129716N/AN/A15601575CCAGGGTAAGGTCCAT452703
1129736N/AN/A17131728TAGGCAAGGATAGGGC662704
1129756N/AN/A22802295TCGCGAATAATGAGAA382705
1129776N/AN/A24592474ATCAGCTTAGCATTGA552706
1129796N/AN/A26282643TCTACTTAGTGCAACG302707
1129816N/AN/A29102925TCACTGTTAACCACTC522708
1129836N/AN/A33763391TGCTCTAAAAGTTGGG632709
1129856N/AN/A37703785GGGTGGTAGCACACCT552710
1129876N/AN/A40194034AAGCTTGGTTTACCCA492711
1129896N/AN/A43214336CGAGTATCCAGCAACC832712
1129916N/AN/A43634378GGGATAGTGGTCTCAG322713
1129936N/AN/A46244639CACCCCTGGGCCTAAA752714
1129956N/AN/A50735088CGCGGCGCACCGGCAG552715
1129976N/AN/A54215436AATCTAGCTCGCCCGG392716
1129996N/AN/A54535468TGAGGACGGAGAGCCC532717
1130016N/AN/A57645779CTGCGCTGGGAGACGG642718
1130036N/AN/A58725887CGAACCCCAATCCCGT572719
1130056N/AN/A61746189CGCAACAGAGCTAACC432720
1130076N/AN/A63606375CCAGTGATCAAAGGTC712721
1130096N/AN/A63926407GATACCAAAGTCGCGG442722
1130116N/AN/A64376452ACAACCCATCAGGTCA542723
1130136N/AN/A65416556ACCAAGAGCAAGTTCG512724
1130156N/AN/A66286643CCAGAGTCGCAGAACC472725
1130176N/AN/A67526767CAGCAAGCCCGAAGGG602726
1130196N/AN/A68156830GCCCGGACGATGGACA472727
1130216N/AN/A70167031TCACCTGGCACGCATC 322728
1130236N/AN/A70947109GAAACACGCAGCTCAG 742729
TABLE 47
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
112871611261126GCCTATCCAGGAGTCC732730
11287368910489104AAAGTGTTGACTCCAA212731
1128756129144496511TTGTACTTATGCTCCT342732
1128776160175N/AN/AGACAGTGAGAACGACT142733
112879621222735633578TGTGGTACAGCTGCCG112734
112880221823335693584TACATTTGTGGTACAG 72426
112881723825335893604GCCTGGCCGGCCCTTG462735
112883729931438063821AACAGTATCCCCATCG302736
112885741442942224237CCAGTGAGGTGTTGTG292737
112887749250744374452GTTCTATACCATATCT242738
1128897572587N/AN/ATGCGGCAGGCCTGGCT722739
112891760261746864701GGCAGCGACCCCCATG242740
112893764265747264741CCCACCGGGCAGTGGC502741
112895768670149154930AGCAGCTTGCCTTGGT192742
112897771873349474962CAGGCCGCGGTAGCTG702743
112899776678149955010CTCCGAGGCCCACGGC432744
112901781182650405055TCCCCAGTTCCGCGCT472745
112903786988451835198CGAAGCACCACGGGCG142746
112905790692152205235TCGCAGTACTCCCAGC152747
1129077993100853075322GGCTGCGCGGGCATGA262748
112909710621077N/AN/AGCCGGCAAGGCTCCCG342749
11291171104111955235538AGTGGGCCGTTCCTGG232750
11291371133114855525567GACTCTTGCGGAGCCG162751
11291571157117255765591CAACGACGCGGGTCAT392752
11291771215123056345649TGGCCCCAGTACAGCG602753
11291971244125956635678GGGCGATGAGGCTGCC672754
11292171349136460096024ACGGCTCACAGCTGTG672755
11292371401141660616076ACGGGCGAGAAGGCCT512756
11292571442145761856200CCTCCTGAAGGCGCAA332757
11292771468148362116226CAGGAGCGCGCAGCTG292758
11292971503151862466261CCGCTTGGCAGGCACA262759
11293171562157763056320CGAACTGGTGGCCCCA352760
11293371584159968826897CTGGCATATTCCTCCG472761
11293571658167369566971TGGAGGATCCGTGCAC  42762
11293771697171269957010CGCCCTCGAGGAACCC 132763
11293971752176771407155GCTTGGTCCTCACACA  62764
11294171803181871917206CAGCCCGATCCCCAGC242765
11294371843185872317246GGCCACATCGGTGTAG452766
11294571877189272657280AAACGGTGTGCTCCCG152767
11294771902191772907305AAAGATGAGTCCCTGA 92768
11294971949196473377352CCTTCCATGCCCCAGC 42769
11295171994200973827397CCTGGCGCGGAGCTGG202770
11295372016203174047419CTTTATTGAGTTCCTG 42771
1129557N/AN/A119134GGACAATCCTGGTTCC552772
1129577N/AN/A206221CATAGGCCTCCTAGTC882773
1129597N/AN/A334349TTTCTACCTCCCCCCG772774
1129617N/AN/A463478GGAATCTACAAGGGAG762775
1129637N/AN/A612627AGGTAGGCACTAGACT672776
1129657N/AN/A659674CACAGCTCACGATCAC582777
1129677N/AN/A958973AATCCCTCGCCCAGAG712778
1129697N/AN/A11251140TCATCTAAAAGGTAGT472779
1129717N/AN/A15611576ACCAGGGTAAGGTCCA562780
1129737N/AN/A17161731GATTAGGCAAGGATAG662781
1129757N/AN/A22812296ATCGCGAATAATGAGA582782
1129777N/AN/A24682483TATAGTGCCATCAGCT602783
1129797N/AN/A26292644GTCTACTTAGTGCAAC642784
1129817N/AN/A29122927AGTCACTGTTAACCAC512785
1129837N/AN/A34013416GTCGCTGTGCATTGAA422786
1129857N/AN/A38813896GTAATGAGGCGGGAGG622787
1129877N/AN/A40354050GCTACTCCAAGTTTCC402788
1129897N/AN/A43224337CCGAGTATCCAGCAAC532789
1129917N/AN/A43654380GAGGGATAGTGGTCTC952790
1129937N/AN/A46344649CGCAGTGAGCCACCCC712791
1129957N/AN/A50745089ACGCGGCGCACCGGCA552792
1129977N/AN/A54225437GAATCTAGCTCGCCCG782793
1129997N/AN/A54825497CGCCGGCAAGGCTGTG772794
1130017N/AN/A57665781AGCTGCGCTGGGAGAC792795
1130037N/AN/A58735888CCGAACCCCAATCCCG972796
1130057N/AN/A61756190GCGCAACAGAGCTAAC572797
1130077N/AN/A63676382GCCTAACCCAGTGATC952798
1130097N/AN/A63936408CGATACCAAAGTCGCG972799
1130117N/AN/A64386453CACAACCCATCAGGTC572800
1130137N/AN/A65676582CCTTTGCAGCCCGGCG692801
1130157N/AN/A66296644TCCAGAGTCGCAGAAC612802
1130177N/AN/A67536768GCAGCAAGCCCGAAGG652803
1130197N/AN/A68166831CGCCCGGACGATGGAC592804
1130217N/AN/A70177032CTCACCTGGCACGCAT 642805
1130237N/AN/A70957110GGAAACACGCAGCTCA 732806
TABLE 48
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
112871712271227TGCCTATCCAGGAGTC972807
11287379010590105GAAAGTGTTGACTCCA242808
1128757131146498513CTTTGTACTTATGCTC462809
1128777161176N/AN/ATGACAGTGAGAACGAC312810
112879721322835643579TTGTGGTACAGCTGCC152811
112880221823335693584TACATTTGTGGTACAG182426
112881824325835943609TGAGGGCCTGGCCGGC682812
112883830031538073822AAACAGTATCCCCATC572813
112885841543042234238TCCAGTGAGGTGTTGT352814
112887849350844384453AGTTCTATACCATATC152815
112889858159646654680ACGGGTTGGTGCGGCA442816
112891860361846874702AGGCAGCGACCCCCAT332817
112893864365847274742GCCCACCGGGCAGTGG832818
112895868970449184933CATAGCAGCTTGCCTT172819
112897872073549494964GCCAGGCCGCGGTAGC632820
112899876778249965011CCTCCGAGGCCCACGG352821
112901881282750415056GTCCCCAGTTCCGCGC662822
112903887088551845199ACGAAGCACCACGGGC302823
112905890792252215236GTCGCAGTACTCCCAG192824
1129078995101053095324CCGGCTGCGCGGGCAT332825
112909810631078N/AN/ACGCCGGCAAGGCTCCC422826
11291181106112155255540TCAGTGGGCCGTTCCT302827
11291381134114955535568AGACTCTTGCGGAGCC212828
11291581158117355775592CCAACGACGCGGGTCA292829
11291781220123556395654AACTGTGGCCCCAGTA422830
11291981261127656805695CGTCAGCACCCAGCAG542831
11292181352136760126027GGCACGGCTCACAGCT342832
11292381402141760626077GACGGGCGAGAAGGCC422833
11292581443145861866201TCCTCCTGAAGGCGCA382834
11292781469148462126227ACAGGAGCGCGCAGCT372835
11292981504151962476262GCCGCTTGGCAGGCAC772836
11293181563157863066321TCGAACTGGTGGCCCC762837
11293381591160668896904CAGGAAGCTGGCATAT592838
11293581659167469576972ATGGAGGATCCGTGCA 102839
11293781698171369967011CCGCCCTCGAGGAACC 162840
11293981753176871417156AGCTTGGTCCTCACAC 222841
11294181806182171947209CCACAGCCCGATCCCC362842
11294381844185972327247AGGCCACATCGGTGTA342843
11294581878189372667281GAAACGGTGTGCTCCC212844
11294781903191872917306GAAAGATGAGTCCCTG152845
11294981950196573387353GCCTTCCATGCCCCAG162846
11295181995201073837398TCCTGGCGCGGAGCTG222847
11295382017203274057420ACTTTATTGAGTTCCT 92848
1129558N/AN/A126141AATCCTGGGACAATCC772849
1129578N/AN/A207222ACATAGGCCTCCTAGT832850
1129598N/AN/A405420GATCTGTTGCTAGTCT772851
1129618N/AN/A466481GGTGGAATCTACAAGG107 2852
1129638N/AN/A613628CAGGTAGGCACTAGAC762853
1129658N/AN/A660675ACACAGCTCACGATCA632854
1129678N/AN/A959974AAATCCCTCGCCCAGA622855
1129698N/AN/A11321147GTACCCTTCATCTAAA832856
1129718N/AN/A15621577CACCAGGGTAAGGTCC642857
1129738N/AN/A17171732GGATTAGGCAAGGATA762858
1129758N/AN/A22822297CATCGCGAATAATGAG492859
1129778N/AN/A24692484CTATAGTGCCATCAGC562860
1129798N/AN/A26312646CAGTCTACTTAGTGCA632861
1129818N/AN/A29632978GAAGAGCACTTGCCAC512862
1129838N/AN/A34043419AAGGTCGCTGTGCATT582863
1129858N/AN/A38823897AGTAATGAGGCGGGAG582864
1129878N/AN/A40454060TTGTGACCTTGCTACT502865
1129898N/AN/A43234338TCCGAGTATCCAGCAA682866
1129918N/AN/A43664381AGAGGGATAGTGGTCT882867
1129938N/AN/A46354650ACGCAGTGAGCCACCC432868
1129958N/AN/A50755090CACGCGGCGCACCGGC662869
1129978N/AN/A54235438GGAATCTAGCTCGCCC742870
1129998N/AN/A54835498TCGCCGGCAAGGCTGT802871
1130018N/AN/A57725787CGTGGAAGCTGCGCTG752872
1130038N/AN/A58775892GCTCCCGAACCCCAAT692873
1130058N/AN/A61766191GGCGCAACAGAGCTAA592874
1130078N/AN/A63686383CGCCTAACCCAGTGAT712875
1130098N/AN/A63946409ACGATACCAAAGTCGC682876
1130118N/AN/A64576472GGATTCACCTACACAT732877
1130138N/AN/A65686583GCCTTTGCAGCCCGGC982878
1130158N/AN/A66306645ATCCAGAGTCGCAGAA622879
1130178N/AN/A67546769CGCAGCAAGCCCGAAG692880
1130198N/AN/A68176832CCGCCCGGACGATGGA782881
1130218N/AN/A70187033GCTCACCTGGCACGCA 982882
1130238N/AN/A70967111CGGAAACACGCAGCTC 792883
TABLE 49
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
112873892107N/AN/ATCGAAAGTGTTGACTC152884
1128758132147499514GCTTTGTACTTATGCT632885
1128778163178N/AN/AGGTGACAGTGAGAACG192886
112879821422935653580TTTGTGGTACAGCTGC282887
112880221823335693584TACATTTGTGGTACAG162426
112881924526035963611GCTGAGGGCCTGGCCG592888
112883930131638083823CAAACAGTATCCCCAT242889
112885942443942324247GCAGTGGTTTCCAGTG172890
112887949450944394454CAGTTCTATACCATAT152891
112889958259746664681CACGGGTTGGTGCGGC332892
112891960461946884703TAGGCAGCGACCCCCA312893
112893964566047294744TAGCCCACCGGGCAGT402894
112895969070549194934TCATAGCAGCTTGCCT222895
112897974475949734988GGCGCACCCGAGAGCG322896
112899976878349975012GCCTCCGAGGCCCACG462897
112901981382850425057AGTCCCCAGTTCCGCG392898
112903987188651855200CACGAAGCACCACGGG162899
112905990892352225237GGTCGCAGTACTCCCA182900
1129079996101153105325GCCGGCTGCGCGGGCA352901
112909910641079N/AN/ATCGCCGGCAAGGCTCC362902
11291191107112255265541CTCAGTGGGCCGTTCC172903
11291391135115055545569CAGACTCTTGCGGAGC122904
11291591159117455785593GCCAACGACGCGGGTC272905
11291791222123756415656GAAACTGTGGCCCCAG182906
11291991286130157055720GCCGGTCCTGCAGGCA332907
11292191353136860136028TGGCACGGCTCACAGC272908
11292391403141860636078TGACGGGCGAGAAGGC472909
11292591445146061886203CATCCTCCTGAAGGCG322910
11292791470148562136228GACAGGAGCGCGCAGC272911
11292991505152062486263CGCCGCTTGGCAGGCA592912
11293191564157963076322CTCGAACTGGTGGCCC372913
11293391592160768906905GCAGGAAGCTGGCATA722914
11293591660167569586973GATGGAGGATCCGTGC 112915
11293791699171469977012GCCGCCCTCGAGGAAC  62916
11293991754176971427157CAGCTTGGTCCTCACA 262917
11294191808182371967211CACCACAGCCCGATCC372918
11294391845186072337248TAGGCCACATCGGTGT312919
11294591879189472677282GGAAACGGTGTGCTCC412920
11294791904191972927307GGAAAGATGAGTCCCT152921
11294991951196673397354TGCCTTCCATGCCCCA 82922
11295191996201173847399ATCCTGGCGCGGAGCT292923
11295392018203374067421CACTTTATTGAGTTCC 62924
1129559N/AN/A138153ACCCCCCAGAACAATC452925
1129579N/AN/A208223CACATAGGCCTCCTAG242926
1129599N/AN/A408423ACCGATCTGTTGCTAG792927
1129619N/AN/A469484CAAGGTGGAATCTACA502928
1129639N/AN/A614629CCAGGTAGGCACTAGA362929
1129659N/AN/A693708TTAGACACAGCCCATA562930
1129679N/AN/A960975CAAATCCCTCGCCCAG302931
1129699N/AN/A11341149AGGTACCCTTCATCTA792932
1129719N/AN/A15831598TCAACCCCACCAAGTC592933
1129739N/AN/A17571772ATGGGATGGACGGACA442934
1129759N/AN/A22832298CCATCGCGAATAATGA502935
1129779N/AN/A24702485GCTATAGTGCCATCAG252936
1129799N/AN/A26512666TATTGAATGAGTGTCC362937
1129819N/AN/A29873002GTAAGTCTTCAGTCCC562938
1129839N/AN/A34053420AAAGGTCGCTGTGCAT582939
1129859N/AN/A38833898GAGTAATGAGGCGGGA552940
1129879N/AN/A40584073GAACCTACTTGCCTTG422941
1129899N/AN/A43244339CTCCGAGTATCCAGCA282942
1129919N/AN/A43674382AAGAGGGATAGTGGTC482943
1129939N/AN/A46364651AACGCAGTGAGCCACC552944
1129959N/AN/A50765091CCACGCGGCGCACCGG612945
1129979N/AN/A54245439CGGAATCTAGCTCGCC452946
1129999N/AN/A54845499TTCGCCGGCAAGGCTG502947
1130019N/AN/A58005815AGAAGGTAGGGCACGG782948
1130039N/AN/A60896104CCACGCACCCAGGTCG872949
1130059N/AN/A61776192AGGCGCAACAGAGCTA322950
1130079N/AN/A63696384CCGCCTAACCCAGTGA282951
1130099N/AN/A63956410AACGATACCAAAGTCG422952
1130119N/AN/A64596474TGGGATTCACCTACAC942953
1130139N/AN/A65766591CCTAGTTGGCCTTTGC462954
1130159N/AN/A66346649ACCCATCCAGAGTCGC662955
1130179N/AN/A67556770TCGCAGCAAGCCCGAA532956
1130199N/AN/A68186833GCCGCCCGGACGATGG842957
1130219N/AN/A70267041GGCTAAGAGCTCACCT 812958
1130239N/AN/A70977112TCGGAAACACGCAGCT 652959
TABLE 50
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
112873993108N/AN/AATCGAAAGTGTTGACT232960
1128759133148500515AGCTTTGTACTTATGC132961
112877916417935153530CGGTGACAGTGAGAAC142962
112879921523035663581ATTTGTGGTACAGCTG 72963
112880221823335693584TACATTTGTGGTACAG 42426
1128820257272N/AN/ATAGCACACCAGGGCTG402964
112884030231738093824CCAAACAGTATCCCCA102965
112886043144642394254CTTTCTGGCAGTGGTT122966
112888049751244424457GCTCAGTTCTATACCA 22967
112890058359846674682GCACGGGTTGGTGCGG382968
112892060762246914706CTCTAGGCAGCGACCC182969
112894064666147304745GTAGCCCACCGGGCAG332970
112896069170649204935ATCATAGCAGCTTGCC152971
112898074576049744989GGGCGCACCCGAGAGC102972
112900077679150055020GGTAGGTGGCCTCCGA102973
112902081482950435058CAGTCCCCAGTTCCGC 82974
112904087288751865201GCACGAAGCACCACGG182975
112906091092552245239CAGGTCGCAGTACTCC242976
1129080998101353125327GTGCCGGCTGCGCGGG152977
112910010651080N/AN/ATTCGCCGGCAAGGCTC362978
11291201108112355275542GCTCAGTGGGCCGTTC102979
11291401136115155555570ACAGACTCTTGCGGAG162980
11291601160117555795594CGCCAACGACGCGGGT212981
11291801223123856425657AGAAACTGTGGCCCCA102982
112920012881303N/AN/AGGGCCGGTCCTGCAGG152983
11292201354136960146029CTGGCACGGCTCACAG232984
11292401404141960646079CTGACGGGCGAGAAGG462985
11292601446146161896204GCATCCTCCTGAAGGC102986
11292801471148662146229CGACAGGAGCGCGCAG392987
11293001518153362616276GAGGGTCGCGCGGCGC242988
11293201565158063086323CCTCGAACTGGTGGCC482989
11293401602161769006915TGCGCCTCCTGCAGGA702990
11293601662167769606975AGGATGGAGGATCCGT 432991
11293801700171569987013TGCCGCCCTCGAGGAA 102992
11294001755177071437158GCAGCTTGGTCCTCAC  82993
11294201811182671997214GGTCACCACAGCCCGA 92994
11294401846186172347249GTAGGCCACATCGGTG122995
11294601880189572687283AGGAAACGGTGTGCTC 72996
11294801905192072937308GGGAAAGATGAGTCCC392997
11295001952196773407355TTGCCTTCCATGCCCC 42998
11295201997201273857400CATCCTGGCGCGGAGC152999
11295402019203474077422GCACTTTATTGAGTTC 33000
1129560N/AN/A139154GACCCCCCAGAACAAT203001
1129580N/AN/A216231CACCTTTCCACATAGG443002
1129600N/AN/A409424CACCGATCTGTTGCTA773003
1129620N/AN/A470485CCAAGGTGGAATCTAC343004
1129640N/AN/A615630ACCAGGTAGGCACTAG233005
1129660N/AN/A694709CTTAGACACAGCCCAT583006
1129680N/AN/A963978ACTCAAATCCCTCGCC233007
1129700N/AN/A11361151GCAGGTACCCTTCATC223008
1129720N/AN/A15861601GACTCAACCCCACCAA323009
1129740N/AN/A17581773GATGGGATGGACGGAC163010
1129760N/AN/A22842299ACCATCGCGAATAATG143011
1129780N/AN/A24872502ACTTGATTCAGGTGTG293012
1129800N/AN/A26522667CTATTGAATGAGTGTC473013
1129820N/AN/A29893004GGGTAAGTCTTCAGTC333014
1129840N/AN/A34063421AAAAGGTCGCTGTGCA493015
1129860N/AN/A38843899AGAGTAATGAGGCGGG273016
1129880N/AN/A40594074TGAACCTACTTGCCTT213017
1129900N/AN/A43254340TCTCCGAGTATCCAGC343018
1129920N/AN/A45294544CGTTCCCAACCATCTG563019
1129940N/AN/A46374652GAACGCAGTGAGCCAC213020
1129960N/AN/A50785093CCCCACGCGGCGCACC443021
1129980N/AN/A54255440CCGGAATCTAGCTCGC323022
1130000N/AN/A57065721CGCCGGTCCTGCAGGC323023
1130020N/AN/A58015816GAGAAGGTAGGGCACG303024
1130040N/AN/A61126127CTTCCCGTCCCCGCGG453025
1130060N/AN/A61786193AAGGCGCAACAGAGCT193026
1130080N/AN/A63706385TCCGCCTAACCCAGTG763027
1130100N/AN/A63966411GAACGATACCAAAGTC383028
1130120N/AN/A64626477ACCTGGGATTCACCTA313029
1130140N/AN/A65776592TCCTAGTTGGCCTTTG233030
1130160N/AN/A66596674CGGAAACAGAAACCCC573031
1130180N/AN/A67566771CTCGCAGCAAGCCCGA463032
1130200N/AN/A68196834TGCCGCCCGGACGATG263033
1130220N/AN/A70287043CGGGCTAAGAGCTCAC 263034
1130240N/AN/A70987113GTCGGAAACACGCAGC 153035
TABLE 51
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
112874094109N/AN/AAATCGAAAGTGTTGAC553036
1128760143158510525TGTGCTCTTCAGCTTT233037
112878016518035163531CCGGTGACAGTGAGAA293038
112880021623135673582CATTTGTGGTACAGCT203039
112880221823335693584TACATTTGTGGTACAG162426
1128821261276N/AN/AGTGGTAGCACACCAGG193040
112884130331838103825TCCAAACAGTATCCCC163041
1128861432447N/AN/ATCTTTCTGGCAGTGGT313042
112888152854344734488CCCTTGCACTGGCATC173043
112890158459946684683GGCACGGGTTGGTGCG693044
112892160862346924707CCTCTAGGCAGCGACC323045
112894164866347324747GTGTAGCCCACCGGGC843046
112896169270749214936CATCATAGCAGCTTGC283047
112898174676149754990AGGGCGCACCCGAGAG253048
112900177779250065021CGGTAGGTGGCCTCCG573049
112902181583050445059CCAGTCCCCAGTTCCG393050
112904187388851875202AGCACGAAGCACCACG253051
112906191192652255240CCAGGTCGCAGTACTC213052
11290811001101653155330GCGGTGCCGGCTGCGC733053
11291011066108154855500CTTCGCCGGCAAGGCT363054
11291211112112755315546CGCAGCTCAGTGGGCC463055
11291411137115255565571GACAGACTCTTGCGGA233056
11291611161117655805595CCGCCAACGACGCGGG383057
11291811224123956435658CAGAAACTGTGGCCCC293058
112920112891304N/AN/ACGGGCCGGTCCTGCAG583059
11292211357137260176032CGTCTGGCACGGCTCA123060
11292411405142060656080GCTGACGGGCGAGAAG303061
11292611448146361916206CCGCATCCTCCTGAAG463062
11292811472148762156230GCGACAGGAGCGCGCA593063
11293011519153462626277GGAGGGTCGCGCGGCG613064
11293211566158163096324CCCTCGAACTGGTGGC703065
11293411606162169046919TACCTGCGCCTCCTGC903066
11293611663167869616976GAGGATGGAGGATCCG 433067
11293811704171970027017TCGGTGCCGCCCTCGA 323068
11294011759177471477162CTCTGCAGCTTGGTCC 323069
11294211814182972027217TGCGGTCACCACAGCC223070
11294411847186272357250AGTAGGCCACATCGGT133071
11294611881189672697284CAGGAAACGGTGTGCT253072
11294811906192172947309AGGGAAAGATGAGTCC103073
11295011954196973427357TCTTGCCTTCCATGCC143074
11295211998201373867401CCATCCTGGCGCGGAG283075
11295412020203574087423AGCACTTTATTGAGTT 83076
1129561N/AN/A140155CGACCCCCCAGAACAA723077
1129581N/AN/A229244TCCGGGCTGGCCTCAC813078
1129601N/AN/A410425CCACCGATCTGTTGCT563079
1129621N/AN/A520535TTACCGACTGTGTGCT303080
1129641N/AN/A619634TAGCACCAGGTAGGCA643081
1129661N/AN/A697712GCACTTAGACACAGCC883082
1129681N/AN/A964979AACTCAAATCCCTCGC703083
1129701N/AN/A11371152GGCAGGTACCCTTCAT151 3084
1129721N/AN/A15901605TAGAGACTCAACCCCA623085
1129741N/AN/A17611776GCAGATGGGATGGACG423086
1129761N/AN/A22852300AACCATCGCGAATAAT503087
1129781N/AN/A24892504ACACTTGATTCAGGTG493088
1129801N/AN/A26532668CCTATTGAATGAGTGT543089
1129821N/AN/A29913006TTGGGTAAGTCTTCAG513090
1129841N/AN/A34073422AAAAAGGTCGCTGTGC523091
1129861N/AN/A38853900GAGAGTAATGAGGCGG543092
1129881N/AN/A40604075TTGAACCTACTTGCCT623093
1129901N/AN/A43264341GTCTCCGAGTATCCAG106 3094
1129921N/AN/A45324547GCCCGTTCCCAACCAT633095
1129941N/AN/A46394654GGGAACGCAGTGAGCC473096
1129961N/AN/A50805095AGCCCCACGCGGCGCA112 3097
1129981N/AN/A54265441GCCGGAATCTAGCTCG493098
1130001N/AN/A57075722TCGCCGGTCCTGCAGG603099
1130021N/AN/A58065821GGCGGGAGAAGGTAGG513100
1130041N/AN/A61586173CGGGCGGAGAGGAGCG118 3101
1130061N/AN/A63106325ACCCTCGAACTGGTGG453102
1130081N/AN/A63716386TTCCGCCTAACCCAGT113 3103
1130101N/AN/A63976412GGAACGATACCAAAGT753104
1130121N/AN/A64636478TACCTGGGATTCACCT593105
1130141N/AN/A65786593GTCCTAGTTGGCCTTT293106
1130161N/AN/A66646679CGGAGCGGAAACAGAA109 3107
1130181N/AN/A67576772TCTCGCAGCAAGCCCG993108
1130201N/AN/A68236838CGCTTGCCGCCCGGAC483109
1130221N/AN/A70297044CCGGGCTAAGAGCTCA 483110
1130241N/AN/A70997114GGTCGGAAACACGCAG 773111
TABLE 52
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1128761145160512527TGTGTGCTCTTCAGCT193112
112878116618135173532CCCGGTGACAGTGAGA183113
112880121723235683583ACATTTGTGGTACAGC 83114
112880221823335693584TACATTTGTGGTACAG 92426
112886246247744074422AACCGGAGAAGCTGAG243115
112888252954444744489ACCCTTGCACTGGCAT323116
112890258560046694684AGGCACGGGTTGGTGC703117
112892260962446934708ACCTCTAGGCAGCGAC193118
112894265066547344749CGGTGTAGCCCACCGG673119
112896269370849224937CCATCATAGCAGCTTG223120
112898274776249764991CAGGGCGCACCCGAGA273121
112900277879350075022CCGGTAGGTGGCCTCC323122
112902282383850525067GTGGCCGCCCAGTCCC173123
112904287488951885203CAGCACGAAGCACCAC213124
112906291292752265241GCCAGGTCGCAGTACT253125
11290821003101853175332CGGCGGTGCCGGCTGC253126
11291021068108354875502CGCTTCGCCGGCAAGG303127
11291221113112855325547CCGCAGCTCAGTGGGC403128
11291421138115355575572AGACAGACTCTTGCGG153129
11291621162117755815596CCCGCCAACGACGCGG433130
11291821225124056445659GCAGAAACTGTGGCCC333131
11292221371138660316046GAGCGCACGGCCAACG233132
11292421406142160666081AGCTGACGGGCGAGAA593133
11292621449146461926207TCCGCATCCTCCTGAA553134
11292821473148862166231GGCGACAGGAGCGCGC343135
11293021520153562636278CGGAGGGTCGCGCGGC653136
11293421607162269056920GTACCTGCGCCTCCTG823137
11293621679169469776992CGCAGAGCATGCCGGG  63138
11293821705172070037018ATCGGTGCCGCCCTCG  83139
11294021774178971627177CAGGGTGAGCCGGCGC313140
11294221815183072037218TTGCGGTCACCACAGC273141
11294421848186372367251TAGTAGGCCACATCGG193142
11294621882189772707285TCAGGAAACGGTGTGC183143
11294821908192372967311GGAGGGAAAGATGAGT153144
11295021955197073437358ATCTTGCCTTCCATGC 93145
11295221999201473877402GCCATCCTGGCGCGGA513146
11295422021203674097424AAGCACTTTATTGAGT123147
1129562N/AN/A141156GCGACCCCCCAGAACA723148
1129582N/AN/A230245TTCCGGGCTGGCCTCA523149
1129602N/AN/A411426GCCACCGATCTGTTGC823150
1129622N/AN/A521536CTTACCGACTGTGTGC523151
1129642N/AN/A623638GACCTAGCACCAGGTA103 3152
1129662N/AN/A699714GGGCACTTAGACACAG553153
1129682N/AN/A965980GAACTCAAATCCCTCG493154
1129702N/AN/A11381153TGGCAGGTACCCTTCA623155
1129722N/AN/A15911606TTAGAGACTCAACCCC623156
1129742N/AN/A19161931CATGAAGTTGTGTGCC673157
1129762N/AN/A22872302ATAACCATCGCGAATA363158
1129782N/AN/A24902505GACACTTGATTCAGGT453159
1129802N/AN/A26542669TCCTATTGAATGAGTG233160
1129822N/AN/A30163031TCCACAACCTGCTAGC743161
1129842N/AN/A34083423CAAAAAGGTCGCTGTG593162
1129862N/AN/A38863901GGAGAGTAATGAGGCG443163
1129882N/AN/A40614076CTTGAACCTACTTGCC503164
1129902N/AN/A43284343AAGTCTCCGAGTATCC613165
1129922N/AN/A45344549TGGCCCGTTCCCAACC463166
1129942N/AN/A48054820AAGCCCGTCCCACCTG463167
1129962N/AN/A50845099ACCCAGCCCCACGCGG603168
1129982N/AN/A54285443TGGCCGGAATCTAGCT119 3169
1130002N/AN/A57085723CTCGCCGGTCCTGCAG543170
1130022N/AN/A58235838CGTGGAAAGAAGGGTG783171
1130042N/AN/A61596174CCGGGCGGAGAGGAGC873172
1130062N/AN/A63116326TACCCTCGAACTGGTG693173
1130082N/AN/A63736388TCTTCCGCCTAACCCA743174
1130102N/AN/A63986413CGGAACGATACCAAAG473175
1130122N/AN/A64646479CTACCTGGGATTCACC853176
1130142N/AN/A65796594CGTCCTAGTTGGCCTT333177
1130162N/AN/A66656680GCGGAGCGGAAACAGA673178
1130182N/AN/A67596774TCTCTCGCAGCAAGCC473179
1130202N/AN/A68366851CCCCATCTGACAACGC103 3180
1130222N/AN/A70307045ACCGGGCTAAGAGCTC 693181
1130242N/AN/A71007115GGGTCGGAAACACGCA 943182
112874195110N/AN/AGAATCGAAAGTGTTGA283183
1128822263278N/AN/AGGGTGGTAGCACACCA363184
1128842327342N/AN/ACAGTGGTCTTTCACTT913185
112920212911306N/AN/ATGCGGGCCGGTCCTGC633186
112932215671582N/AN/ACCCCTCGAACTGGTGG863187
TABLE 53
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)No.
112872227422742GTCCGTTGGTCCAGCT343188
112874296111N/AN/AGGAATCGAAAGTGTTG193189
1128762146161513528CTGTGTGCTCTTCAGC113190
112878216818335193534TCCCCGGTGACAGTGA163191
112880221823335693584TACATTTGTGGTACAG 72426
112880321923435703585GTACATTTGTGGTACA413192
112882327829337853800CCTGATCAAAGTTGGG253193
1128843328343N/AN/AGCAGTGGTCTTTCACT343194
112886346347844084423AAACCGGAGAAGCTGA343195
112888353154644764491GGACCCTTGCACTGGC333196
112890358660146704685GAGGCACGGGTTGGTG333197
112892361062546944709CACCTCTAGGCAGCGA263198
112894365166647354750CCGGTGTAGCCCACCG453199
112896369571049244939GGCCATCATAGCAGCT353200
112898374876349774992ACAGGGCGCACCCGAG193201
112900377979450085023TCCGGTAGGTGGCCTC323202
1129023838853N/AN/AGTTCCGGCAGAAGGCG203203
112904387789251915206GTTCAGCACGAAGCAC143204
112906391392852275242TGCCAGGTCGCAGTAC373205
11290831004101953185333TCGGCGGTGCCGGCTG183206
11291031069108454885503CCGCTTCGCCGGCAAG443207
11291231114112955335548CCCGCAGCTCAGTGGG353208
11291431139115455585573AAGACAGACTCTTGCG163209
11291631163117855825597GCCCGCCAACGACGCG393210
11291831226124156455660CGCAGAAACTGTGGCC363211
112920312921307N/AN/AGTGCGGGCCGGTCCTG623212
11292231373138860336048AGGAGCGCACGGCCAA273213
11292431411142660716086CTGGTAGCTGACGGGC243214
11292631450146561936208GTCCGCATCCTCCTGA403215
11292831474148962176232AGGCGACAGGAGCGCG203216
11293031521153662646279TCGGAGGGTCGCGCGG483217
112932315681583N/AN/ACCCCCTCGAACTGGTG583218
11293431609162469076922CGGTACCTGCGCCTCC873219
11293631680169569786993GCGCAGAGCATGCCGG 443220
11293831706172170047019CATCGGTGCCGCCCTC 153221
11294031775179071637178GCAGGGTGAGCCGGCG273222
11294231817183272057220TGTTGCGGTCACCACA113223
11294431849186472377252GTAGTAGGCCACATCG203224
11294631883189872717286ATCAGGAAACGGTGTG383225
11294831919193473077322GGAATCACCAAGGAGG 53226
11295031957197273457360CAATCTTGCCTTCCAT143227
11295232000201573887403CGCCATCCTGGCGCGG573228
11295432022203774107425AAAGCACTTTATTGAG 93229
1129563N/AN/A142157AGCGACCCCCCAGAAC423230
1129583N/AN/A232247CCTTCCGGGCTGGCCT553231
1129603N/AN/A412427TGCCACCGATCTGTTG603232
1129623N/AN/A526541GGCCACTTACCGACTG783233
1129643N/AN/A624639AGACCTAGCACCAGGT533234
1129663N/AN/A701716GTGGGCACTTAGACAC633235
1129683N/AN/A10031018TCAACCTGGTTTCACA203236
1129703N/AN/A11391154ATGGCAGGTACCCTTC213237
1129723N/AN/A15921607CTTAGAGACTCAACCC363238
1129743N/AN/A19171932GCATGAAGTTGTGTGC723239
1129763N/AN/A22882303CATAACCATCGCGAAT293240
1129783N/AN/A24942509GTTAGACACTTGATTC213241
1129803N/AN/A26552670CTCCTATTGAATGAGT643242
1129823N/AN/A30313046GAGTAGACTCCTGACT803243
1129843N/AN/A34093424TCAAAAAGGTCGCTGT643244
1129863N/AN/A38953910GTGATACCAGGAGAGT363245
1129883N/AN/A40624077TCTTGAACCTACTTGC323246
1129903N/AN/A43304345CCAAGTCTCCGAGTAT683247
1129923N/AN/A45354550CTGGCCCGTTCCCAAC413248
1129943N/AN/A48084823GGCAAGCCCGTCCCAC213249
1129963N/AN/A51485163CTGTAGCCACACGACG853250
1129983N/AN/A54295444CTGGCCGGAATCTAGC923251
1130003N/AN/A57095724ACTCGCCGGTCCTGCA363252
1130023N/AN/A58415856CCGGGAGCTCCGGAGG693253
1130043N/AN/A61606175CCCGGGCGGAGAGGAG853254
1130063N/AN/A63126327CTACCCTCGAACTGGT523255
1130083N/AN/A63756390CTTCTTCCGCCTAACC513256
1130103N/AN/A63996414CCGGAACGATACCAAA723257
1130123N/AN/A64756490GCCCTGGGATTCTACC543258
1130143N/AN/A66006615TAGCCCGGAGCGCGGG613259
1130163N/AN/A66666681GGCGGAGCGGAAACAG493260
1130183N/AN/A67606775CTCTCTCGCAGCAAGC433261
1130203N/AN/A68386853CACCCCATCTGACAAC453262
1130223N/AN/A70317046AACCGGGCTAAGAGCT 623263
1130243N/AN/A71017116TGGGTCGGAAACACGC 333264
TABLE 54
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)No.
112872329442944CCGTCCGTTGGTCCAG253265
112874397112N/AN/ATGGAATCGAAAGTGTT423266
1128763147162514529ACTGTGTGCTCTTCAG203267
112878316918435203535CTCCCCGGTGACAGTG363268
112880221823335693584TACATTTGTGGTACAG122426
112880422023535713586GGTACATTTGTGGTAC393269
112882427929437863801TCCTGATCAAAGTTGG323270
1128844330345N/AN/ACTGCAGTGGTCTTTCA873271
112886446447944094424AAAACCGGAGAAGCTG323272
112888453555044804495ATCAGGACCCTTGCAC323273
112890458760246714686GGAGGCACGGGTTGGT413274
112892461262746964711TCCACCTCTAGGCAGC263275
112894465266747364751TCCGGTGTAGCCCACC313276
112896469771249264941GCGGCCATCATAGCAG703277
112898474976449784993GACAGGGCGCACCCGA283278
112900478079550095024TTCCGGTAGGTGGCCT383279
1129024839854N/AN/AGGTTCCGGCAGAAGGC273280
112904488189651955210CGCGGTTCAGCACGAA213281
112906494195652555270GCGCCGCCTGGGTTGG483282
11290841005102053195334TTCGGCGGTGCCGGCT173283
11291041070108554895504CCCGCTTCGCCGGCAA203284
11291241115113055345549GCCCGCAGCTCAGTGG393285
11291441141115655605575CGAAGACAGACTCTTG203286
11291641165118055845599CAGCCCGCCAACGACG473287
11291841227124256465661GCGCAGAAACTGTGGC513288
11292041302131759625977AGATCCTCGGGTGCGG223289
11292241374138960346049TAGGAGCGCACGGCCA273290
11292441412142760726087GCTGGTAGCTGACGGG443291
11292641452146761956210CCGTCCGCATCCTCCT243292
11292841475149062186233AAGGCGACAGGAGCGC213293
11293041522153762656280CTCGGAGGGTCGCGCG263294
112932415691584N/AN/AGCCCCCTCGAACTGGT110 3295
11293441610162569086923ACGGTACCTGCGCCTC633296
11293641681169669796994TGCGCAGAGCATGCCG 443297
11293841707172270057020GCATCGGTGCCGCCCT 363298
11294041776179171647179TGCAGGGTGAGCCGGC543299
11294241819183472077222CTTGTTGCGGTCACCA173300
11294441850186572387253GGTAGTAGGCCACATC233301
11294641884189972727287AATCAGGAAACGGTGT283302
11294841920193573087323CGGAATCACCAAGGAG 93303
11295041958197373467361ACAATCTTGCCTTCCA153304
11295242002201773907405TGCGCCATCCTGGCGC423305
11295442023203874117426CAAAGCACTTTATTGA213306
1129564N/AN/A143158TAGCGACCCCCCAGAA343307
1129584N/AN/A271286GTATCCACCCAGTCTG673308
1129604N/AN/A415430GCCTGCCACCGATCTG813309
1129624N/AN/A528543CAGGCCACTTACCGAC373310
1129644N/AN/A626641TAAGACCTAGCACCAG693311
1129664N/AN/A702717CGTGGGCACTTAGACA473312
1129684N/AN/A10041019ATCAACCTGGTTTCAC333313
1129704N/AN/A12031218GTAATTTAGTGTCTGG383314
1129724N/AN/A15931608GCTTAGAGACTCAACC603315
1129744N/AN/A20822097TGGACCTTTAAGATGC263316
1129764N/AN/A22892304ACATAACCATCGCGAA453317
1129784N/AN/A24992514CGTGTGTTAGACACTT423318
1129804N/AN/A26562671TCTCCTATTGAATGAG793319
1129824N/AN/A30323047GGAGTAGACTCCTGAC853320
1129844N/AN/A34103425CTCAAAAAGGTCGCTG433321
1129864N/AN/A38973912TGGTGATACCAGGAGA213322
1129884N/AN/A40664081CCCTTCTTGAACCTAC583323
1129904N/AN/A43324347TGCCAAGTCTCCGAGT523324
1129924N/AN/A45834598TGGCACACCACCCGGC513325
1129944N/AN/A48094824TGGCAAGCCCGTCCCA413326
1129964N/AN/A51495164CCTGTAGCCACACGAC613327
1129984N/AN/A54335448CCGGCTGGCCGGAATC633328
1130004N/AN/A57105725TACTCGCCGGTCCTGC343329
1130024N/AN/A58425857CCCGGGAGCTCCGGAG138 3330
1130044N/AN/A61616176ACCCGGGCGGAGAGGA383331
1130064N/AN/A63136328CCTACCCTCGAACTGG623332
1130084N/AN/A63806395GCGGGCTTCTTCCGCC103 3333
1130104N/AN/A64006415CCCGGAACGATACCAA753334
1130124N/AN/A65276542CGATTCTCCCTGTATC343335
1130144N/AN/A66026617ACTAGCCCGGAGCGCG563336
1130164N/AN/A66676682GGGCGGAGCGGAAACA873337
1130184N/AN/A67816796GTAAACCCACTCATGC633338
1130204N/AN/A68416856TCACACCCCATCTGAC523339
1130224N/AN/A70327047CAACCGGGCTAAGAGC 743340
1130244N/AN/A71027117CTGGGTCGGAAACACG 573341
TABLE 55
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
112874498113N/AN/AGTGGAATCGAAAGTGT373342
1128764148163515530GACTGTGTGCTCTTCA123343
112878417018535213536GCTCCCCGGTGACAGT443344
112880221823335693584TACATTTGTGGTACAG132426
112880522123635723587GGGTACATTTGTGGTA353345
112882528429937913806GCTGGTCCTGATCAAA313346
112884536538041734188CACAGGTCCCTCCTTT413347
112886546548044104425AAAAACCGGAGAAGCT573348
112888553655144814496CATCAGGACCCTTGCA513349
112890558960446734688ATGGAGGCACGGGTTG343350
112892561963447034718GTGGCCCTCCACCTCT373351
112894565366847374752CTCCGGTGTAGCCCAC513352
112896569871349274942CGCGGCCATCATAGCA763353
112898575076549794994TGACAGGGCGCACCCG433354
112900578179650105025GTTCCGGTAGGTGGCC493355
1129025840855N/AN/AGGGTTCCGGCAGAAGG373356
112904588289751965211TCGCGGTTCAGCACGA413357
112906597398852875302GACATGAAGCCTAGGG173358
11290851006102153205335CTTCGGCGGTGCCGGC413359
11291051071108654905505TCCCGCTTCGCCGGCA353360
11291251117113255365551CTGCCCGCAGCTCAGT363361
11291451142115755615576TCGAAGACAGACTCTT313362
11291651168118355875602CACCAGCCCGCCAACG533363
11291851228124356475662GGCGCAGAAACTGTGG423364
11292051304131959645979TCAGATCCTCGGGTGC293365
11292251375139060356050GTAGGAGCGCACGGCC323366
11292451413142860736088TGCTGGTAGCTGACGG363367
11292651454146961976212TGCCGTCCGCATCCTC403368
11292851476149162196234TAAGGCGACAGGAGCG333369
11293051523153862666281TCTCGGAGGGTCGCGC393370
112932515701585N/AN/ACGCCCCCTCGAACTGG131 3371
11293451611162669096924AACGGTACCTGCGCCT823372
11293651684169969826997CCCTGCGCAGAGCATG 213373
11293851708172370067021CGCATCGGTGCCGCCC 173374
11294051777179271657180TTGCAGGGTGAGCCGG403375
11294251820183572087223GCTTGTTGCGGTCACC273376
11294451851186672397254AGGTAGTAGGCCACAT233377
11294651885190072737288CAATCAGGAAACGGTG293378
11294851921193673097324GCGGAATCACCAAGGA 73379
11295051962197773507365GGACACAATCTTGCCT343380
11295252003201873917406CTGCGCCATCCTGGCG653381
11295452024203974127427TCAAAGCACTTTATTG153382
1129565N/AN/A144159ATAGCGACCCCCCAGA463383
1129585N/AN/A273288TTGTATCCACCCAGTC933384
1129605N/AN/A420435TCATAGCCTGCCACCG733385
1129625N/AN/A554569ACCCAAGGGTTCCCGG142 3386
1129645N/AN/A629644GCATAAGACCTAGCAC803387
1129665N/AN/A725740AAGCACCTGCTCCGAG783388
1129685N/AN/A10091024CTGTTATCAACCTGGT643389
1129705N/AN/A12041219GGTAATTTAGTGTCTG483390
1129725N/AN/A15941609TGCTTAGAGACTCAAC763391
1129745N/AN/A20842099GATGGACCTTTAAGAT723392
1129765N/AN/A22902305AACATAACCATCGCGA553393
1129785N/AN/A25132528CCTTAGGGAGAAAGCG513394
1129805N/AN/A26592674AGCTCTCCTATTGAAT693395
1129825N/AN/A30343049CTGGAGTAGACTCCTG663396
1129845N/AN/A34113426CCTCAAAAAGGTCGCT593397
1129865N/AN/A39003915GTCTGGTGATACCAGG543398
1129885N/AN/A40694084AGGCCCTTCTTGAACC723399
1129905N/AN/A43334348ATGCCAAGTCTCCGAG683400
1129925N/AN/A45844599CTGGCACACCACCCGG683401
1129945N/AN/A48104825CTGGCAAGCCCGTCCC483402
1129965N/AN/A51505165TCCTGTAGCCACACGA109 3403
1129985N/AN/A54345449GCCGGCTGGCCGGAAT893404
1130005N/AN/A57115726GTACTCGCCGGTCCTG763405
1130025N/AN/A58435858CCCCGGGAGCTCCGGA773406
1130045N/AN/A61626177AACCCGGGCGGAGAGG963407
1130065N/AN/A63146329GCCTACCCTCGAACTG853408
1130085N/AN/A63816396CGCGGGCTTCTTCCGC883409
1130105N/AN/A64016416ACCCGGAACGATACCA693410
1130125N/AN/A65296544TTCGATTCTCCCTGTA773411
1130145N/AN/A66036618CACTAGCCCGGAGCGC803412
1130165N/AN/A66686683TGGGCGGAGCGGAAAC803413
1130185N/AN/A67836798TTGTAAACCCACTCAT823414
1130205N/AN/A68626877TGCGAACACAGAGCGC113 3415
1130225N/AN/A70337048CCAACCGGGCTAAGAG 653416
1130245N/AN/A71037118CCTGGGTCGGAAACAC 803417
TABLE 56
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
112874599114N/AN/AGGTGGAATCGAAAGTG453418
1128765149164516531CGACTGTGTGCTCTTC133419
112878517118635223537GGCTCCCCGGTGACAG373420
112880221823335693584TACATTTGTGGTACAG142426
112880622223735733588TGGGTACATTTGTGGT333421
112882628530037923807CGCTGGTCCTGATCAA233422
112884636638141744189ACACAGGTCCCTCCTT483423
112886646648144114426GAAAAACCGGAGAAGC463424
112888653755244824497GCATCAGGACCCTTGC673425
112890659060546744689CATGGAGGCACGGGTT293426
112892662363847074722GGCGGTGGCCCTCCAC383427
112894665466947384753GCTCCGGTGTAGCCCA693428
112896669971449284943CCGCGGCCATCATAGC773429
112898675176649804995CTGACAGGGCGCACCC383430
112900679981450285043CGCTTGCTCGGCAGTC233431
1129026841856N/AN/ACGGGTTCCGGCAGAAG403432
112904688389851975212GTCGCGGTTCAGCACG243433
112906697498952885303GGACATGAAGCCTAGG233434
11290861007102253215336GCTTCGGCGGTGCCGG333435
11291061073108854925507GCTCCCGCTTCGCCGG523436
11291261119113455385553CGCTGCCCGCAGCTCA313437
11291461143115855625577ATCGAAGACAGACTCT253438
11291661171118655905605CGCCACCAGCCCGCCA453439
11291861229124456485663CGGCGCAGAAACTGTG363440
11292061306132159665981CGTCAGATCCTCGGGT303441
11292261377139260376052CGGTAGGAGCGCACGG253442
112924614291444N/AN/ACAACAGAGCCAGGTCG363443
11292661455147061986213CTGCCGTCCGCATCCT423444
11292861477149262206235GTAAGGCGACAGGAGC233445
11293061524153962676282GTCTCGGAGGGTCGCG333446
112932615711586N/AN/ACCGCCCCCTCGAACTG693447
11293461612162769106925GAACGGTACCTGCGCC963448
11293661685170069836998ACCCTGCGCAGAGCAT 193449
11293861709172470077022ACGCATCGGTGCCGCC 173450
11294061780179571687183GCCTTGCAGGGTGAGC253451
11294261821183672097224GGCTTGTTGCGGTCAC163452
11294461852186772407255CAGGTAGTAGGCCACA253453
11294661888190372767291GAGCAATCAGGAAACG203454
11294861922193773107325TGCGGAATCACCAAGG 93455
11295061964197973527367TGGGACACAATCTTGC253456
11295262004201973927407CCTGCGCCATCCTGGC213457
11295462031204674197434AGCATTTTCAAAGCAC513458
1129566N/AN/A145160GATAGCGACCCCCCAG533459
1129586N/AN/A277292GCCCTTGTATCCACCC803460
1129606N/AN/A422437AGTCATAGCCTGCCAC110 3461
1129626N/AN/A555570CACCCAAGGGTTCCCG813462
1129646N/AN/A630645GGCATAAGACCTAGCA733463
1129666N/AN/A727742TCAAGCACCTGCTCCG533464
1129686N/AN/A10101025ACTGTTATCAACCTGG543465
1129706N/AN/A12061221TAGGTAATTTAGTGTC553466
1129726N/AN/A15961611CATGCTTAGAGACTCA513467
1129746N/AN/A20922107GGATCTGAGATGGACC433468
1129766N/AN/A22912306GAACATAACCATCGCG603469
1129786N/AN/A25192534AGGCTACCTTAGGGAG643470
1129806N/AN/A26832698CGTCACGCTGCTGCTG453471
1129826N/AN/A30353050GCTGGAGTAGACTCCT543472
1129846N/AN/A34123427CCCTCAAAAAGGTCGC713473
1129866N/AN/A39563971CAAAGGGTATTGTGGA483474
1129886N/AN/A43064321CTATTCTGTAGGCCCA623475
1129906N/AN/A43434358GTCTAGGACCATGCCA953476
1129926N/AN/A46074622ACCCCCCCAGAGAGCT913477
1129946N/AN/A48124827TCCTGGCAAGCCCGTC373478
1129966N/AN/A51575172TCCGGGTTCCTGTAGC603479
1129986N/AN/A54365451CGGCCGGCTGGCCGGA843480
1130006N/AN/A57125727GGTACTCGCCGGTCCT503481
1130026N/AN/A58445859TCCCCGGGAGCTCCGG102 3482
1130046N/AN/A61636178TAACCCGGGCGGAGAG883483
1130066N/AN/A63156330TGCCTACCCTCGAACT100 3484
1130086N/AN/A63826397TCGCGGGCTTCTTCCG563485
1130106N/AN/A64026417CACCCGGAACGATACC673486
1130126N/AN/A65316546AGTTCGATTCTCCCTG573487
1130146N/AN/A66046619ACACTAGCCCGGAGCG663488
1130166N/AN/A66696684ATGGGCGGAGCGGAAA108 3489
1130186N/AN/A67846799CTTGTAAACCCACTCA573490
1130206N/AN/A68636878CTGCGAACACAGAGCG100 3491
1130226N/AN/A70347049GCCAACCGGGCTAAGA1343492
1130246N/AN/A71047119CCCTGGGTCGGAAACA 873493
TABLE 57
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1128746101116N/AN/AAAGGTGGAATCGAAAG683494
1128766150165N/AN/AACGACTGTGTGCTCTT203495
112878617519035263541GCAGGGCTCCCCGGTG453496
112880221823335693584TACATTTGTGGTACAG382426
112880722323835743589GTGGGTACATTTGTGG573497
112882728730237943809ATCGCTGGTCCTGATC573498
112884737038541784193GTTCACACAGGTCCCT403499
112886746748244124427GGAAAAACCGGAGAAG633500
112888753855344834498GGCATCAGGACCCTTG583501
112890759160646754690CCATGGAGGCACGGGT503502
112892762463947084723AGGCGGTGGCCCTCCA693503
112894765567047394754GGCTCCGGTGTAGCCC973504
112896770071549294944CCCGCGGCCATCATAG100 3505
112898775276749814996GCTGACAGGGCGCACC483506
112900780181650305045CGCGCTTGCTCGGCAG713507
1129027842857N/AN/ACCGGGTTCCGGCAGAA513508
112904788489951985213GGTCGCGGTTCAGCAC443509
112906797699152905305TGGGACATGAAGCCTA613510
11290871008102353225337GGCTTCGGCGGTGCCG793511
11291071079109454985513GCGGCTGCTCCCGCTT753512
11291271121113655405555GCCGCTGCCCGCAGCT593513
11291471144115955635578CATCGAAGACAGACTC453514
11291671202121756215636GCGCGGCGATGTAGGG573515
11291871230124556495664CCGGCGCAGAAACTGT733516
11292071309132459695984CACCGTCAGATCCTCG523517
11292271378139360386053GCGGTAGGAGCGCACG413518
112924714311446N/AN/ACGCAACAGAGCCAGGT483519
11292671456147161996214GCTGCCGTCCGCATCC613520
11292871478149362216236CGTAAGGCGACAGGAG363521
11293071525154062686283GGTCTCGGAGGGTCGC693522
112932715721587N/AN/ATCCGCCCCCTCGAACT128 3523
11293471613162869116926GGAACGGTACCTGCGC181 3524
11293671686170169846999AACCCTGCGCAGAGCA 173525
11293871710172570087023CACGCATCGGTGCCGC 303526
11294071781179671697184TGCCTTGCAGGGTGAG233527
11294271822183772107225TGGCTTGTTGCGGTCA593528
11294471853186872417256CCAGGTAGTAGGCCAC563529
11294671892190772807295CCCTGAGCAATCAGGA483530
11294871923193873117326CTGCGGAATCACCAAG303531
11295071965198073537368ATGGGACACAATCTTG703532
11295272005202073937408TCCTGCGCCATCCTGG333533
11295472033204874217436TCAGCATTTTCAAAGC403534
1129567N/AN/A146161TGATAGCGACCCCCCA673535
1129587N/AN/A279294GTGCCCTTGTATCCAC763536
1129607N/AN/A423438AAGTCATAGCCTGCCA115 3537
1129627N/AN/A571586GCACCATACACATCCC573538
1129647N/AN/A631646GGGCATAAGACCTAGC763539
1129667N/AN/A736751GCACATATCTCAAGCA533540
1129687N/AN/A10171032GAGGTTTACTGTTATC783541
1129707N/AN/A12071222GTAGGTAATTTAGTGT733542
1129727N/AN/A15991614CGCCATGCTTAGAGAC823543
1129747N/AN/A21322147TGCCAAGGACCAAACC723544
1129767N/AN/A22922307AGAACATAACCATCGC633545
1129787N/AN/A25202535AAGGCTACCTTAGGGA943546
1129807N/AN/A26972712AAGGTTCAACAAGGCG613547
1129827N/AN/A30363051AGCTGGAGTAGACTCC753548
1129847N/AN/A34693484CCCTGTACTCAACTGC653549
1129867N/AN/A39573972CCAAAGGGTATTGTGG743550
1129887N/AN/A43084323ACCTATTCTGTAGGCC883551
1129907N/AN/A43444359AGTCTAGGACCATGCC100 3552
1129927N/AN/A46114626AAAGACCCCCCCAGAG116 3553
1129947N/AN/A48374852TGCTTTCCGCACTCTC543554
1129967N/AN/A51585173GTCCGGGTTCCTGTAG853555
1129987N/AN/A54385453CGCGGCCGGCTGGCCG893556
1130007N/AN/A57135728GGGTACTCGCCGGTCC623557
1130027N/AN/A58625877TCCCGTGTTCCAGCTT803558
1130047N/AN/A61646179CTAACCCGGGCGGAGA803559
1130067N/AN/A63166331GTGCCTACCCTCGAAC112 3560
1130087N/AN/A63836398GTCGCGGGCTTCTTCC543561
1130107N/AN/A64036418GCACCCGGAACGATAC803562
1130127N/AN/A65326547AAGTTCGATTCTCCCT703563
1130147N/AN/A66056620CACACTAGCCCGGAGC863564
1130167N/AN/A66706685AATGGGCGGAGCGGAA793565
1130187N/AN/A67856800GCTTGTAAACCCACTC733566
1130207N/AN/A68656880CCCTGCGAACACAGAG913567
1130227N/AN/A70357050CGCCAACCGGGCTAAG 983568
1130247N/AN/A71057120ACCCTGGGTCGGAAAC 963569
TABLE 58
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1128747102117N/AN/ACAAGGTGGAATCGAAA213570
1128767151166N/AN/AAACGACTGTGTGCTCT433571
112878717619135273542GGCAGGGCTCCCCGGT453572
112880221823335693584TACATTTGTGGTACAG202426
112880822423935753590TGTGGGTACATTTGTG303573
112882828830337953810CATCGCTGGTCCTGAT463574
112884837338841814196CATGTTCACACAGGTC313575
112886846848344134428TGGAAAAACCGGAGAA473576
112888853955444844499GGGCATCAGGACCCTT693577
112890859260746764691CCCATGGAGGCACGGG763578
112892862564047094724CAGGCGGTGGCCCTCC443579
112894865767247414756AAGGCTCCGGTGTAGC733580
112896870171649304945GCCCGCGGCCATCATA523581
112898875376849824997GGCTGACAGGGCGCAC403582
112900880281750315046CCGCGCTTGCTCGGCA353583
1129028843858N/AN/ATCCGGGTTCCGGCAGA353584
112904888590051995214CGGTCGCGGTTCAGCA393585
112906897799252915306GTGGGACATGAAGCCT313586
11290881009102453235338AGGCTTCGGCGGTGCC783587
11291081082109755015516AAGGCGGCTGCTCCCG463588
11291281124113955435558GGAGCCGCTGCCCGCA403589
11291481145116055645579TCATCGAAGACAGACT363590
11291681203121856225637AGCGCGGCGATGTAGG543591
11291881231124656505665GCCGGCGCAGAAACTG813592
11292081311132659715986ACCACCGTCAGATCCT483593
11292281379139460396054AGCGGTAGGAGCGCAC483594
112924814331448N/AN/AGGCGCAACAGAGCCAG633595
11292681457147262006215AGCTGCCGTCCGCATC423596
11292881492150762356250GCACACCGGCTGAACG523597
11293081542155762856300GCCACCTGGCAGAGCG733598
112932815731588N/AN/ACTCCGCCCCCTCGAAC135 3599
11293481614162969126927AGGAACGGTACCTGCG127 3600
11293681688170369867001GGAACCCTGCGCAGAG  73601
11293881711172670097024GCACGCATCGGTGCCG 843602
11294081785180071737188ATGATGCCTTGCAGGG163603
11294281823183872117226CTGGCTTGTTGCGGTC483604
11294481854186972427257GCCAGGTAGTAGGCCA643605
11294681893190872817296TCCCTGAGCAATCAGG453606
11294881924193973127327ACTGCGGAATCACCAA203607
11295081967198273557370GAATGGGACACAATCT633608
11295282006202173947409TTCCTGCGCCATCCTG353609
1129548N/AN/A92107CCGAAAGTGTTGACTC443610
1129568N/AN/A147162GTGATAGCGACCCCCC583611
1129588N/AN/A323338CCCCGTTGTCTTCTTA803612
1129608N/AN/A425440ATAAGTCATAGCCTGC933613
1129628N/AN/A598613CTAGACTGCCCTGAGA553614
1129648N/AN/A636651CCCATGGGCATAAGAC893615
1129668N/AN/A737752AGCACATATCTCAAGC753616
1129688N/AN/A10221037CCTAAGAGGTTTACTG783617
1129708N/AN/A12081223TGTAGGTAATTTAGTG673618
1129728N/AN/A16951710CAAGTTTGGGTAAGGC573619
1129748N/AN/A21372152GCACTTGCCAAGGACC423620
1129768N/AN/A22932308TAGAACATAACCATCG593621
1129788N/AN/A25212536GAAGGCTACCTTAGGG613622
1129808N/AN/A27002715GTTAAGGTTCAACAAG593623
1129828N/AN/A30373052TAGCTGGAGTAGACTC623624
1129848N/AN/A34763491GGACTTCCCCTGTACT703625
1129868N/AN/A39583973TCCAAAGGGTATTGTG643626
1129888N/AN/A43094324AACCTATTCTGTAGGC743627
1129908N/AN/A43454360GAGTCTAGGACCATGC853628
1129928N/AN/A46134628CTAAAGACCCCCCCAG773629
1129948N/AN/A48404855ATCTGCTTTCCGCACT233630
1129968N/AN/A51595174TGTCCGGGTTCCTGTA593631
1129988N/AN/A54405455CCCGCGGCCGGCTGGC913632
1130008N/AN/A57155730GCGGGTACTCGCCGGT663633
1130028N/AN/A58645879AATCCCGTGTTCCAGC623634
1130048N/AN/A61656180GCTAACCCGGGCGGAG973635
1130068N/AN/A63226337GCAGTTGTGCCTACCC533636
1130088N/AN/A63846399AGTCGCGGGCTTCTTC783637
1130108N/AN/A64056420AGGCACCCGGAACGAT623638
1130128N/AN/A65336548CAAGTTCGATTCTCCC583639
1130148N/AN/A66066621CCACACTAGCCCGGAG813640
1130168N/AN/A66716686GAATGGGCGGAGCGGA863641
1130188N/AN/A67866801CGCTTGTAAACCCACT583642
1130208N/AN/A68666881CCCCTGCGAACACAGA111 3643
1130228N/AN/A70367051GCGCCAACCGGGCTAA 783644
1130248N/AN/A71067121CACCCTGGGTCGGAAA 673645
TABLE 59
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1128748103118N/AN/ACCAAGGTGGAATCGAA493646
1128768152167N/AN/AGAACGACTGTGTGCTC293647
112878817719235283543TGGCAGGGCTCCCCGG553648
112880221823335693584TACATTTGTGGTACAG352426
112880922524035763591TTGTGGGTACATTTGT513649
112882929030537973812CCCATCGCTGGTCCTG493650
112884938039541884203CGCTTGGCATGTTCAC413651
112886946948444144429GTGGAAAAACCGGAGA583652
112888954055544854500TGGGCATCAGGACCCT793653
112890959360846774692CCCCATGGAGGCACGG523654
112892962664147104725ACAGGCGGTGGCCCTC483655
112894966067547444759CAGAAGGCTCCGGTGT793656
112896970371849324947GAGCCCGCGGCCATCA683657
112898975476949834998CGGCTGACAGGGCGCA563658
112900980381850325047TCCGCGCTTGCTCGGC573659
1129029844859N/AN/AGTCCGGGTTCCGGCAG513660
112904988690152005215CCGGTCGCGGTTCAGC553661
112906997899352925307AGTGGGACATGAAGCC413662
11290891010102553245339GAGGCTTCGGCGGTGC593663
11291091083109855025517GAAGGCGGCTGCTCCC543664
11291291125114055445559CGGAGCCGCTGCCCGC703665
11291491146116155655580GTCATCGAAGACAGAC583666
11291691204121956235638CAGCGCGGCGATGTAG613667
11291891233124856525667CTGCCGGCGCAGAAAC653668
11292091312132759725987CACCACCGTCAGATCC643669
11292291380139560406055AAGCGGTAGGAGCGCA663670
112924914341449N/AN/AAGGCGCAACAGAGCCA743671
11292691458147362016216CAGCTGCCGTCCGCAT553672
11292891493150862366251GGCACACCGGCTGAAC563673
11293091545156062886303CCGGCCACCTGGCAGA120 3674
112932915751590N/AN/ATCCTCCGCCCCCTCGA145 3675
11293491615163069136928GAGGAACGGTACCTGC953676
11293691689170469877002AGGAACCCTGCGCAGA 203677
11293891713172870117026TGGCACGCATCGGTGC 653678
11294091788180371767191CTGATGATGCCTTGCA373679
11294291824183972127227CCTGGCTTGTTGCGGT523680
11294491855187072437258GGCCAGGTAGTAGGCC883681
11294691894190972827297GTCCCTGAGCAATCAG403682
11294891925194073137328CACTGCGGAATCACCA293683
11295091968198373567371GGAATGGGACACAATC453684
11295292007202273957410GTTCCTGCGCCATCCT373685
1129549N/AN/A93108ACCGAAAGTGTTGACT633686
1129569N/AN/A148163TGTGATAGCGACCCCC743687
1129589N/AN/A324339CCCCCGTTGTCTTCTT117 3688
1129609N/AN/A426441TATAAGTCATAGCCTG663689
1129629N/AN/A600615GACTAGACTGCCCTGA843690
1129649N/AN/A637652GCCCATGGGCATAAGA833691
1129669N/AN/A744759CGCCAGCAGCACATAT783692
1129689N/AN/A10231038CCCTAAGAGGTTTACT983693
1129709N/AN/A12141229CTGGCATGTAGGTAAT753694
1129729N/AN/A16961711CCAAGTTTGGGTAAGG803695
1129749N/AN/A21392154GTGCACTTGCCAAGGA803696
1129769N/AN/A23212336TGCTAGTTCAATGTTC513697
1129789N/AN/A25232538AAGAAGGCTACCTTAG883698
1129809N/AN/A27032718CCAGTTAAGGTTCAAC643699
1129829N/AN/A30383053ATAGCTGGAGTAGACT803700
1129849N/AN/A34953510GGGACAACACACTCTC683701
1129869N/AN/A39633978GGACTTCCAAAGGGTA663702
1129889N/AN/A43104325CAACCTATTCTGTAGG653703
1129909N/AN/A43474362GAGAGTCTAGGACCAT106 3704
1129929N/AN/A46154630GCCTAAAGACCCCCCC883705
1129949N/AN/A48444859TCTCATCTGCTTTCCG353706
1129969N/AN/A51605175TTGTCCGGGTTCCTGT673707
1129989N/AN/A54435458GAGCCCGCGGCCGGCT933708
1130009N/AN/A57165731GGCGGGTACTCGCCGG963709
1130029N/AN/A58655880CAATCCCGTGTTCCAG703710
1130049N/AN/A61666181AGCTAACCCGGGCGGA105 3711
1130069N/AN/A63246339TAGCAGTTGTGCCTAC703712
1130089N/AN/A63856400AAGTCGCGGGCTTCTT933713
1130109N/AN/A64076422GTAGGCACCCGGAACG793714
1130129N/AN/A65346549GCAAGTTCGATTCTCC703715
1130149N/AN/A66086623TCCCACACTAGCCCGG833716
1130169N/AN/A66726687TGAATGGGCGGAGCGG883717
1130189N/AN/A67876802GCGCTTGTAAACCCAC913718
1130209N/AN/A68676882GCCCCTGCGAACACAG853719
1130229N/AN/A70577072GCCTGACGGCCTCGGG 773720
1130249N/AN/A71077122TCACCCTGGGTCGGAA 863721
TABLE 60
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1128749104119N/AN/ACCCAAGGTGGAATCGA633722
1128769153168N/AN/AAGAACGACTGTGTGCT333723
112878917819335293544GTGGCAGGGCTCCCCG443724
112880221823335693584TACATTTGTGGTACAG242426
112881022624135773592CTTGTGGGTACATTTG403725
112883029130637983813CCCCATCGCTGGTCCT403726
112885038139641894204CCGCTTGGCATGTTCA493727
112887047048544154430TGTGGAAAAACCGGAG273728
112889054155644864501GTGGGCATCAGGACCC913729
112891059460946784693CCCCCATGGAGGCACG633730
112893062764247114726CACAGGCGGTGGCCCT533731
112895066167647454760GCAGAAGGCTCCGGTG118 3732
112897070672149354950GCTGAGCCCGCGGCCA613733
112899075577049844999ACGGCTGACAGGGCGC613734
112901080481950335048TTCCGCGCTTGCTCGG129 3735
1129030845860N/AN/ATGTCCGGGTTCCGGCA523736
112905088790252015216GCCGGTCGCGGTTCAG473737
112907097999452935308GAGTGGGACATGAAGC743738
11290901013102853275342GCTGAGGCTTCGGCGG523739
11291101085110055045519GGGAAGGCGGCTGCTC683740
11291301126114155455560GCGGAGCCGCTGCCCG763741
11291501147116255665581GGTCATCGAAGACAGA523742
11291701206122156255640TACAGCGCGGCGATGT106 3743
11291901236125156555670AGGCTGCCGGCGCAGA513744
11292101314132959745989AGCACCACCGTCAGAT723745
11292301381139660416056CAAGCGGTAGGAGCGC613746
112925014351450N/AN/AAAGGCGCAACAGAGCC603747
11292701459147462026217GCAGCTGCCGTCCGCA543748
11292901494150962376252AGGCACACCGGCTGAA633749
11293101546156162896304GCCGGCCACCTGGCAG933750
112933015771592N/AN/AATTCCTCCGCCCCCTC189 3751
11293501616163169146929AGAGGAACGGTACCTG993752
11293701690170569887003GAGGAACCCTGCGCAG 173753
11293901714172970127027CTGGCACGCATCGGTG 303754
11294101789180471777192GCTGATGATGCCTTGC423755
11294301825184072137228GCCTGGCTTGTTGCGG603756
11294501856187172447259AGGCCAGGTAGTAGGC923757
11294701895191072837298AGTCCCTGAGCAATCA533758
11294901926194173147329TCACTGCGGAATCACC173759
11295101984199973727387AGCTGGCCGCACTGGG363760
11295302008202373967411AGTTCCTGCGCCATCC193761
1129550N/AN/A94109CACCGAAAGTGTTGAC118 3762
1129570N/AN/A149164CTGTGATAGCGACCCC963763
1129590N/AN/A325340CCCCCCGTTGTCTTCT118 3764
1129610N/AN/A427442CTATAAGTCATAGCCT139 3765
1129630N/AN/A602617TAGACTAGACTGCCCT783766
1129650N/AN/A644659CTCTAGTGCCCATGGG753767
1129670N/AN/A866881CCCATTGAAGGCCCTG753768
1129690N/AN/A10241039ACCCTAAGAGGTTTAC106 3769
1129710N/AN/A15221537TGCCACACTCTAGGTA983770
1129730N/AN/A16991714GCACCAAGTTTGGGTA100 3771
1129750N/AN/A21412156AAGTGCACTTGCCAAG107 3772
1129770N/AN/A23762391GCTGTTGGTTGATGAA853773
1129790N/AN/A25242539CAAGAAGGCTACCTTA146 3774
1129810N/AN/A27082723CATTCCCAGTTAAGGT853775
1129830N/AN/A30393054GATAGCTGGAGTAGAC108 3776
1129850N/AN/A36093624TAGTCTTACCAGGGCT823777
1129870N/AN/A39954010ATGGGACCACTCCTTC763778
1129890N/AN/A43114326GCAACCTATTCTGTAG109 3779
1129910N/AN/A43484363GGAGAGTCTAGGACCA115 3780
1129930N/AN/A46164631GGCCTAAAGACCCCCC143 3781
1129950N/AN/A50675082GCACCGGCAGAAGGCG633782
1129970N/AN/A53745389TTCCTAACCTCCCGGG973783
1129990N/AN/A54465461GGAGAGCCCGCGGCCG953784
1130010N/AN/A57525767ACGGAGGAGCCGCGGC623785
1130030N/AN/A58665881CCAATCCCGTGTTCCA843786
1130050N/AN/A61676182GAGCTAACCCGGGCGG963787
1130070N/AN/A63276342CCCTAGCAGTTGTGCC104 3788
1130090N/AN/A63866401AAAGTCGCGGGCTTCT923789
1130110N/AN/A64096424CTGTAGGCACCCGGAA164 3790
1130130N/AN/A65356550AGCAAGTTCGATTCTC803791
1130150N/AN/A66216636CGCAGAACCTGGCTCC953792
1130170N/AN/A66736688TTGAATGGGCGGAGCG126 3793
1130190N/AN/A68096824ACGATGGACAAAGCTG147 3794
1130210N/AN/A68706885TCCGCCCCTGCGAACA143 3795
1130230N/AN/A70647079GATTTGTGCCTGACGG 933796
1130250N/AN/A71097124AATCACCCTGGGTCGG1153797
TABLE 61
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1128750105120N/AN/ATCCCAAGGTGGAATCG663798
1128770154169N/AN/AGAGAACGACTGTGTGC473799
112879019821335493564CGGTGGTACTGGAAGG453800
112880221823335693584TACATTTGTGGTACAG282426
112881122824335793594CCCTTGTGGGTACATT753801
112883129230737993814TCCCCATCGCTGGTCC703802
112885138239741904205GCCGCTTGGCATGTTC533803
112887147248744174432CTTGTGGAAAAACCGG373804
112889154255744874502AGTGGGCATCAGGACC643805
112891159561046794694ACCCCCATGGAGGCAC493806
112893162864347124727GCACAGGCGGTGGCCC663807
112895166267747464761CGCAGAAGGCTCCGGT953808
112897171172649404955CGGTAGCTGAGCCCGC102 3809
112899175677149855000CACGGCTGACAGGGCG533810
112901180582050345049GTTCCGCGCTTGCTCG433811
1129031846861N/AN/ATTGTCCGGGTTCCGGC473812
112905188890352025217AGCCGGTCGCGGTTCA183813
112907198099552945309TGAGTGGGACATGAAG503814
11290911014102953285343GGCTGAGGCTTCGGCG543815
11291111086110155055520AGGGAAGGCGGCTGCT443816
11291311127114255465561TGCGGAGCCGCTGCCC593817
11291511150116555695584GCGGGTCATCGAAGAC523818
11291711207122256265641GTACAGCGCGGCGATG573819
11291911238125356575672TGAGGCTGCCGGCGCA653820
11292111315133059755990GAGCACCACCGTCAGA363821
11292311382139760426057GCAAGCGGTAGGAGCG533822
11292511436145161796194GAAGGCGCAACAGAGC603823
11292711460147562036218CGCAGCTGCCGTCCGC503824
11292911495151062386253CAGGCACACCGGCTGA533825
11293111554156962976312TGGCCCCAGCCGGCCA783826
112933115781593N/AN/ATATTCCTCCGCCCCCT140 3827
11293511617163269156930GAGAGGAACGGTACCT120 3828
11293711691170669897004CGAGGAACCCTGCGCA 413829
11293911746176171347149TCCTCACACACCAGCG 153830
11294111790180571787193AGCTGATGATGCCTTG403831
11294311826184172147229CGCCTGGCTTGTTGCG833832
11294511864187972527267CCGGATCCAGGCCAGG663833
11294711896191172847299GAGTCCCTGAGCAATC433834
11294911927194273157330CTCACTGCGGAATCAC213835
11295111988200373767391GCGGAGCTGGCCGCAC563836
11295312009202473977412GAGTTCCTGCGCCATC183837
1129551N/AN/A95110TCACCGAAAGTGTTGA863838
1129571N/AN/A150165GCTGTGATAGCGACCC783839
1129591N/AN/A326341TCCCCCCGTTGTCTTC116 3840
1129611N/AN/A428443ACTATAAGTCATAGCC953841
1129631N/AN/A603618CTAGACTAGACTGCCC923842
1129651N/AN/A645660ACTCTAGTGCCCATGG863843
1129671N/AN/A867882GCCCATTGAAGGCCCT833844
1129691N/AN/A10531068ATACCTCACATGGGTT145 3845
1129711N/AN/A15551570GTAAGGTCCATCTGGT723846
1129731N/AN/A17041719ATAGGGCACCAAGTTT933847
1129751N/AN/A21432158CAAAGTGCACTTGCCA733848
1129771N/AN/A24452460GATGAATCAGCAACAC563849
1129791N/AN/A25252540ACAAGAAGGCTACCTT793850
1129811N/AN/A27462761CCATTTGTGGGCATGC643851
1129831N/AN/A30403055AGATAGCTGGAGTAGA873852
1129851N/AN/A36103625GTAGTCTTACCAGGGC723853
1129871N/AN/A39964011AATGGGACCACTCCTT603854
1129891N/AN/A43124327AGCAACCTATTCTGTA953855
1129911N/AN/A43494364AGGAGAGTCTAGGACC116 3856
1129931N/AN/A46174632GGGCCTAAAGACCCCC943857
1129951N/AN/A50685083CGCACCGGCAGAAGGC753858
1129971N/AN/A53755390CTTCCTAACCTCCCGG763859
1129991N/AN/A54485463ACGGAGAGCCCGCGGC943860
1130011N/AN/A57535768GACGGAGGAGCCGCGG983861
1130031N/AN/A58675882CCCAATCCCGTGTTCC763862
1130051N/AN/A61686183AGAGCTAACCCGGGCG913863
1130071N/AN/A63286343CCCCTAGCAGTTGTGC763864
1130091N/AN/A63876402CAAAGTCGCGGGCTTC673865
1130111N/AN/A64106425TCTGTAGGCACCCGGA733866
1130131N/AN/A65366551GAGCAAGTTCGATTCT813867
1130151N/AN/A66226637TCGCAGAACCTGGCTC763868
1130171N/AN/A66746689TTTGAATGGGCGGAGC843869
1130191N/AN/A68106825GACGATGGACAAAGCT823870
1130211N/AN/A68716886CTCCGCCCCTGCGAAC122 3871
1130231N/AN/A70657080AGATTTGTGCCTGACG 843872
1130251N/AN/A71117126GGAATCACCCTGGGTC 553873
TABLE 62
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 3000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
1128751107122474489CTTCCCAAGGTGGAAT893874
1128771155170N/AN/ATGAGAACGACTGTGTG493875
112879119921435503565CCGGTGGTACTGGAAG553876
112880221823335693584TACATTTGTGGTACAG122426
112881222924435803595GCCCTTGTGGGTACAT563877
112883229330838003815ATCCCCATCGCTGGTC363878
112885238339841914206GGCCGCTTGGCATGTT543879
112887248049544254440ATCTCATTCTTGTGGA323880
112889254355844884503CAGTGGGCATCAGGAC483881
112891259761246814696CGACCCCCATGGAGGC363882
112893263064547144729TGGCACAGGCGGTGGC523883
112895266367847474762TCGCAGAAGGCTCCGG873884
112897271272749414956GCGGTAGCTGAGCCCG663885
112899275877349875002CCCACGGCTGACAGGG733886
112901280682150355050AGTTCCGCGCTTGCTC343887
112903286287751765191CCACGGGCGGATGTCG433888
112905288990452035218CAGCCGGTCGCGGTTC383889
112907298199652955310ATGAGTGGGACATGAA553890
11290921016103153305345TGGGCTGAGGCTTCGG253891
11291121088110355075522TCAGGGAAGGCGGCTG453892
11291321128114355475562TTGCGGAGCCGCTGCC583893
11291521151116655705585CGCGGGTCATCGAAGA443894
11291721208122356275642AGTACAGCGCGGCGAT313895
11291921239125456585673ATGAGGCTGCCGGCGC433896
11292121318133359785993GCCGAGCACCACCGTC403897
11292321383139860436058TGCAAGCGGTAGGAGC333898
11292521437145261806195TGAAGGCGCAACAGAG443899
11292721462147762056220CGCGCAGCTGCCGTCC433900
11292921496151162396254GCAGGCACACCGGCTG343901
11293121556157162996314GGTGGCCCCAGCCGGC603902
112933215791594N/AN/AATATTCCTCCGCCCCC893903
11293521618163369166931GGAGAGGAACGGTACC893904
11293721692170769907005TCGAGGAACCCTGCGC 463905
11293921747176271357150GTCCTCACACACCAGC  53906
11294121797181271857200GATCCCCAGCTGATGA433907
11294321827184272157230ACGCCTGGCTTGTTGC433908
11294521865188072537268CCCGGATCCAGGCCAG413909
11294721897191272857300TGAGTCCCTGAGCAAT243910
11294921928194373167331TCTCACTGCGGAATCA143911
11295121989200473777392CGCGGAGCTGGCCGCA393912
11295322010202573987413TGAGTTCCTGCGCCAT163913
1129552N/AN/A96111CTCACCGAAAGTGTTG883914
1129572N/AN/A186201GGACCCACAGGTCATG283915
1129592N/AN/A327342CTCCCCCCGTTGTCTT853916
1129612N/AN/A429444GACTATAAGTCATAGC101 3917
1129632N/AN/A604619ACTAGACTAGACTGCC793918
1129652N/AN/A649664GATCACTCTAGTGCCC493919
1129672N/AN/A889904GACAAGCTCTTGATCC403920
1129692N/AN/A10541069AATACCTCACATGGGT513921
1129712N/AN/A15561571GGTAAGGTCCATCTGG473922
1129732N/AN/A17081723AAGGATAGGGCACCAA533923
1129752N/AN/A21452160GGCAAAGTGCACTTGC803924
1129772N/AN/A24492464CATTGATGAATCAGCA533925
1129792N/AN/A25262541CACAAGAAGGCTACCT693926
1129812N/AN/A28062821GTGCCTACTTGCTGAA723927
1129832N/AN/A30413056CAGATAGCTGGAGTAG393928
1129852N/AN/A36473662GTACATGTCTCCCAGG553929
1129872N/AN/A40144029TGGTTTACCCACCTGC593930
1129892N/AN/A43134328CAGCAACCTATTCTGT883931
1129912N/AN/A43504365CAGGAGAGTCTAGGAC693932
1129932N/AN/A46184633TGGGCCTAAAGACCCC963933
1129952N/AN/A50695084GCGCACCGGCAGAAGG101 3934
1129972N/AN/A53765391ACTTCCTAACCTCCCG563935
1129992N/AN/A54495464GACGGAGAGCCCGCGG883936
1130012N/AN/A57545769AGACGGAGGAGCCGCG593937
1130032N/AN/A58685883CCCCAATCCCGTGTTC823938
1130052N/AN/A61696184CAGAGCTAACCCGGGC693939
1130072N/AN/A63296344GCCCCTAGCAGTTGTG863940
1130092N/AN/A63886403CCAAAGTCGCGGGCTT543941
1130112N/AN/A64126427ATTCTGTAGGCACCCG463942
1130132N/AN/A65376552AGAGCAAGTTCGATTC513943
1130152N/AN/A66236638GTCGCAGAACCTGGCT603944
1130172N/AN/A66756690ATTTGAATGGGCGGAG443945
1130192N/AN/A68116826GGACGATGGACAAAGC663946
1130212N/AN/A68736888TCCTCCGCCCCTGCGA152 3947
1130232N/AN/A70667081GAGATTTGTGCCTGAC 653948
1130252N/AN/A71127127CGGAATCACCCTGGGT 223949
TABLE 63
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7, electroporation, 2000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
112880221823335693584TACATTTGTGGTACAG124 2426
11295312009202473977412GAGTTCCTGCGCCATC133837
1129948N/AN/A48404855ATCTGCTTTCCGCACT134 3630
1194296N/AN/A48484863TCCCTCTCATCTGCTT553950
1206493N/AN/A48304845CGCACTCTCCCTCCTC105 3951
1208291N/AN/A130145GAACAATCCTGGGACA843952
1208323N/AN/A200215CCTCCTAGTCACCTGG443953
1208358N/AN/A269284ATCCACCCAGTCTGGT123 3954
1208388N/AN/A315330TCTTCTTAAGGCCCAT763955
1208422N/AN/A407422CCGATCTGTTGCTAGT113 3956
1208453N/AN/A442457AAGGCAGGGAACTGAC913957
1208484N/AN/A531546AGCCAGGCCACTTACC123 3958
1208512N/AN/A599614ACTAGACTGCCCTGAG102 3959
1208540N/AN/A632647TGGGCATAAGACCTAG113 3960
1208572N/AN/A662677TCACACAGCTCACGAT773961
1208588N/AN/A734749ACATATCTCAAGCACC119 3962
1208601N/AN/A841856TGGCATGAATGATGCC127 3963
1208614N/AN/A887902CAAGCTCTTGATCCTT563964
1208627N/AN/A927942GTGATAAAGCTGGGCT101 3965
1208640N/AN/A969984TGGAGAACTCAAATCC523966
1208653N/AN/A10151030GGTTTACTGTTATCAA120 3967
1208666N/AN/A10571072CTGAATACCTCACATG107 3968
1208679N/AN/A11261141TTCATCTAAAAGGTAG733969
1208692N/AN/A11651180TATGGCAGAGCTTGAG723970
1208705N/AN/A15171532CACTCTAGGTAAATTT843971
1208718N/AN/A15671582AGGCCCACCAGGGTAA111 3972
1208735N/AN/A15971612CCATGCTTAGAGACTC833973
1208762N/AN/A16901705TTGGGTAAGGCAAGAG483974
1208789N/AN/A17181733GGGATTAGGCAAGGAT743975
1208813N/AN/A19211936CTGAGCATGAAGTTGT803976
1208840N/AN/A20942109ATGGATCTGAGATGGA523977
1208868N/AN/A21262141GGACCAAACCAGAACT983978
1208895N/AN/A21492164TCAAGGCAAAGTGCAC473979
1208918N/AN/A21822197TACCTGCTCAATAAGC463980
1208944N/AN/A22512266CTTCAGAGGAATTGTC643981
1208971N/AN/A23202335GCTAGTTCAATGTTCA983982
1208997N/AN/A23372352GGAACCTAATACTGTT733983
1209023N/AN/A23892404AACCAGATTATATGCT803984
1209048N/AN/A24612476CCATCAGCTTAGCATT533985
1209073N/AN/A24932508TTAGACACTTGATTCA763986
1209100N/AN/A25482563GAAGAGCTGTGTAGTT953987
1209126N/AN/A26472662GAATGAGTGTCCTTCT433988
1209152N/AN/A27072722ATTCCCAGTTAAGGTT783989
1209180N/AN/A27502765ATGGCCATTTGTGGGC983990
1209206N/AN/A27852800TTTGTAACTCCCAAGT803991
1209229N/AN/A28172832ACATTGAGAATGTGCC993992
1209253N/AN/A28962911TCTGATCTGAGCCTTG103 3993
1209277N/AN/A29572972CACTTGCCACAAAGTA743994
1209303N/AN/A30193034GACTCCACAACCTGCT130 3995
1209329N/AN/A33713386TAAAAGTTGGGTTCAG783996
1209347N/AN/A34413456CCTCAGGGTCTGGTCA117 3997
1209360N/AN/A34743489ACTTCCCCTGTACTCA143 3998
1209373N/AN/A35113526GACAGTGAGAACTGCA123 3999
1209386N/AN/A36583673GGACAGGCAGGGTACA764000
1209399N/AN/A37033718CCCTATCACAGTCCCC644001
1209412N/AN/A38793894AATGAGGCGGGAGGAG122 4002
1209425N/AN/A39233938GTCCAGAATCCCAGGT864003
1209438N/AN/A39984013AAAATGGGACCACTCC144 4004
1209451N/AN/A40344049CTACTCCAAGTTTCCA714005
1209464N/AN/A40674082GCCCTTCTTGAACCTA884006
1209477N/AN/A42694284ACCCCGCCCAGGTCCT484007
1209490N/AN/A43314346GCCAAGTCTCCGAGTA764008
1209503N/AN/A43644379AGGGATAGTGGTCTCA734009
1209516N/AN/A46094624AGACCCCCCCAGAGAG714010
1209529N/AN/A48034818GCCCGTCCCACCTGGG784011
1209542N/AN/A51195134GCGCCGGGAGCCCGGA624012
1209555N/AN/A54305445GCTGGCCGGAATCTAG614013
1209568N/AN/A57455760AGCCGCGGCCCCTGGG494014
1209581N/AN/A58605875CCGTGTTCCAGCTTCC534015
1209594N/AN/A60956110GCGCCCCCACGCACCC744016
1209607N/AN/A63576372GTGATCAAAGGTCTCC264017
1209620N/AN/A64366451CAACCCATCAGGTCAG414018
1209633N/AN/A64746489CCCTGGGATTCTACCT654019
1209646N/AN/A65426557AACCAAGAGCAAGTTC384020
1209659N/AN/A66256640GAGTCGCAGAACCTGG254021
1209672N/AN/A66806695CCAGGATTTGAATGGG834022
1209685N/AN/A67806795TAAACCCACTCATGCC444023
1209698N/AN/A68396854ACACCCCATCTGACAA634024
1209711N/AN/A70277042GGGCTAAGAGCTCACC 884025
TABLE 64
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform PS internucleoside linkages
(Huh7 , electroporation, 2000 nM modified oligonucleotide)
SEQSEQSEQSEQ
IDIDIDID
NO: 1NO: 1NO: 2NO: 2SEQ
CompoundStartStopStartStopFXIIID
NumberSiteSiteSiteSiteSequence (5′ to 3′)(% UTC)NO
112880221823335693584TACATTTGTGGTACAG882426
11295312009202473977412GAGTTCCTGCGCCATC 73837
1129948N/AN/A48404855ATCTGCTTTCCGCACT843630
1194286N/AN/A48354850CTTTCCGCACTCTCCC974026
1194297N/AN/A48494864CTCCCTCTCATCTGCT544027
1208292N/AN/A131146AGAACAATCCTGGGAC914028
1208327N/AN/A201216GCCTCCTAGTCACCTG108 4029
1208361N/AN/A270285TATCCACCCAGTCTGG734030
1208392N/AN/A316331GTCTTCTTAAGGCCCA794031
1208426N/AN/A413428CTGCCACCGATCTGTT574032
1208454N/AN/A460475ATCTACAAGGGAGAGA107 4033
1208487N/AN/A546561GTTCCCGGGAGGAGGA694034
1208513N/AN/A601616AGACTAGACTGCCCTG434035
1208544N/AN/A633648ATGGGCATAAGACCTA604036
1208575N/AN/A664679GATCACACAGCTCACG112 4037
1208589N/AN/A735750CACATATCTCAAGCAC654038
1208602N/AN/A842857GTGGCATGAATGATGC944039
1208615N/AN/A888903ACAAGCTCTTGATCCT964040
1208628N/AN/A928943AGTGATAAAGCTGGGC894041
1208641N/AN/A970985TTGGAGAACTCAAATC814042
1208654N/AN/A10161031AGGTTTACTGTTATCA954043
1208667N/AN/A10581073GCTGAATACCTCACAT744044
1208680N/AN/A11281143CCTTCATCTAAAAGGT113 4045
1208693N/AN/A11661181CTATGGCAGAGCTTGA111 4046
1208706N/AN/A15181533ACACTCTAGGTAAATT834047
1208719N/AN/A15731588CAAGTCAGGCCCACCA168 4048
1208738N/AN/A15981613GCCATGCTTAGAGACT474049
1208764N/AN/A16911706TTTGGGTAAGGCAAGA534050
1208792N/AN/A17511766TGGACGGACAGAGAGG644051
1208816N/AN/A19221937GCTGAGCATGAAGTTG384052
1208843N/AN/A21112126TAGGACAGTAAATGGA644053
1208870N/AN/A21272142AGGACCAAACCAGAAC125 4054
1208896N/AN/A21512166GTTCAAGGCAAAGTGC684055
1208921N/AN/A21832198GTACCTGCTCAATAAG102 4056
1208947N/AN/A22662281AATTGCCTGTGTCTTC474057
1208973N/AN/A23222337TTGCTAGTTCAATGTT604058
1209000N/AN/A23382353AGGAACCTAATACTGT104 4059
1209024N/AN/A23902405AAACCAGATTATATGC754060
1209050N/AN/A24632478TGCCATCAGCTTAGCA724061
1209076N/AN/A24952510TGTTAGACACTTGATT924062
1209101N/AN/A25492564TGAAGAGCTGTGTAGT834063
1209127N/AN/A26482663TGAATGAGTGTCCTTC131 4064
1209155N/AN/A27092724ACATTCCCAGTTAAGG934065
1209183N/AN/A27712786GTCAATACTTGAAATG884066
1209207N/AN/A27862801ATTTGTAACTCCCAAG108 4067
1209232N/AN/A28182833TACATTGAGAATGTGC724068
1209254N/AN/A29012916ACCACTCTGATCTGAG704069
1209280N/AN/A29622977AAGAGCACTTGCCACA774070
1209305N/AN/A30283043TAGACTCCTGACTCCA141 4071
1209332N/AN/A33723387CTAAAAGTTGGGTTCA774072
1209348N/AN/A34603475CAACTGCTCAGGCACT117 4073
1209361N/AN/A34853500ACTCTCTGAGGACTTC101 4074
1209374N/AN/A36053620CTTACCAGGGCTGAGG934075
1209387N/AN/A36603675AAGGACAGGCAGGGTA864076
1209400N/AN/A37053720TGCCCTATCACAGTCC964077
1209413N/AN/A38803895TAATGAGGCGGGAGGA106 4078
1209426N/AN/A39493964TATTGTGGAGGGAGAG131 4079
1209439N/AN/A39994014CAAAATGGGACCACTC584080
1209452N/AN/A40364051TGCTACTCCAAGTTTC724081
1209465N/AN/A40684083GGCCCTTCTTGAACCT474082
1209478N/AN/A42714286GCACCCCGCCCAGGTC904083
1209491N/AN/A43344349CATGCCAAGTCTCCGA734084
1209504N/AN/A43684383AAAGAGGGATAGTGGT474085
1209517N/AN/A46124627TAAAGACCCCCCCAGA954086
1209530N/AN/A48044819AGCCCGTCCCACCTGG974087
1209543N/AN/A51465161GTAGCCACACGACGGG314088
1209556N/AN/A54315446GGCTGGCCGGAATCTA374089
1209569N/AN/A57465761GAGCCGCGGCCCCTGG674090
1209582N/AN/A58635878ATCCCGTGTTCCAGCT584091
1209595N/AN/A61116126TTCCCGTCCCCGCGGG824092
1209608N/AN/A63596374CAGTGATCAAAGGTCT344093
1209621N/AN/A64396454TCACAACCCATCAGGT434094
1209634N/AN/A64766491GGCCCTGGGATTCTAC894095
1209647N/AN/A65436558GAACCAAGAGCAAGTT644096
1209660N/AN/A66316646CATCCAGAGTCGCAGA364097
1209673N/AN/A66816696GCCAGGATTTGAATGG844098
1209686N/AN/A67826797TGTAAACCCACTCATG101 4099
1209699N/AN/A68406855CACACCCCATCTGACA864100
1209712N/AN/A70587073TGCCTGACGGCCTCGG 474101
TABLE 65
Reduction of FXII RNA by 3-10-3 cEt gapmers with
uniform PS internucleoside linkages (Huh7,
electroporation, 2000 nM modified oligonucleotide)
SEQ IDSEQ IDSEQ IDSEQ ID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopSequenceFXIISEQ ID
NumberSiteSiteSiteSite(5′ to 3′)(% UTC)NO
1128802 218 23335693584TACATTTGTGGTACAG102 2426
11295312009202473977412GAGTTCCTGCGCCATC253837
1129948N/AN/A48404855ATCTGCTTTCCGCACT763630
1194287N/AN/A48364851GCTTTCCGCACTCTCC484102
1206494N/AN/A48544869CCTGCCTCCCTCTCAT924103
1208296N/AN/A133148CCAGAACAATCCTGGG624104
1208328N/AN/A203218AGGCCTCCTAGTCACC564105
1208363N/AN/A274289CTTGTATCCACCCAGT794106
1208393N/AN/A321336CCGTTGTCTTCTTAAG674107
1208427N/AN/A414429CCTGCCACCGATCTGT944108
1208458N/AN/A461476AATCTACAAGGGAGAG554109
1208489N/AN/A547562GGTTCCCGGGAGGAGG514110
1208515N/AN/A605620CACTAGACTAGACTGC694111
1208545N/AN/A634649CATGGGCATAAGACCT524112
1208577N/AN/A672687CCCTCAAGGATCACAC684113
1208590N/AN/A738753CAGCACATATCTCAAG644114
1208603N/AN/A862877TTGAAGGCCCTGGCCT454115
1208616N/AN/A895910GCCAGAGACAAGCTCT874116
1208629N/AN/A932947CATAAGTGATAAAGCT794117
1208642N/AN/A975990GAAGCTTGGAGAACTC884118
1208655N/AN/A10181033AGAGGTTTACTGTTAT574119
1208668N/AN/A10621077ATGGGCTGAATACCTC954120
1208681N/AN/A11291144CCCTTCATCTAAAAGG133 4121
1208694N/AN/A11671182GCTATGGCAGAGCTTG844122
1208707N/AN/A15191534CACACTCTAGGTAAAT764123
1208720N/AN/A15741589CCAAGTCAGGCCCACC744124
1208739N/AN/A16001615ACGCCATGCTTAGAGA764125
1208766N/AN/A16921707GTTTGGGTAAGGCAAG604126
1208795N/AN/A17561771TGGGATGGACGGACAG834127
1208817N/AN/A19231938AGCTGAGCATGAAGTT144 4128
1208844N/AN/A21122127CTAGGACAGTAAATGG734129
1208873N/AN/A21292144CAAGGACCAAACCAGA914130
1208898N/AN/A21522167TGTTCAAGGCAAAGTG724131
1208922N/AN/A21902205GCACAAAGTACCTGCT714132
1208948N/AN/A22672282GAATTGCCTGTGTCTT724133
1208976N/AN/A23232338TTTGCTAGTTCAATGT624134
1209001N/AN/A23392354CAGGAACCTAATACTG614135
1209027N/AN/A24422457GAATCAGCAACACATA854136
1209051N/AN/A24652480AGTGCCATCAGCTTAG111 4137
1209077N/AN/A24962511GTGTTAGACACTTGAT764138
1209104N/AN/A25512566GCTGAAGAGCTGTGTA744139
1209130N/AN/A26492664TTGAATGAGTGTCCTT102 4140
1209156N/AN/A27102725CACATTCCCAGTTAAG100 4141
1209184N/AN/A27742789CAAGTCAATACTTGAA504142
1209209N/AN/A28032818CCTACTTGCTGAATTT964143
1209234N/AN/A28192834CTACATTGAGAATGTG554144
1209257N/AN/A29022917AACCACTCTGATCTGA684145
1209281N/AN/A29642979GGAAGAGCACTTGCCA794146
1209307N/AN/A30293044GTAGACTCCTGACTCC794147
1209333N/AN/A33743389CTCTAAAAGTTGGGTT554148
1209349N/AN/A34613476TCAACTGCTCAGGCAC734149
1209362N/AN/A34913506CAACACACTCTCTGAG694150
1209375N/AN/A36063621TCTTACCAGGGCTGAG904151
1209388N/AN/A36693684CTTGGACAGAAGGACA934152
1209401N/AN/A37063721CTGCCCTATCACAGTC654153
1209414N/AN/A38873902AGGAGAGTAATGAGGC804154
1209427N/AN/A39503965GTATTGTGGAGGGAGA704155
1209440N/AN/A40034018CCTGCAAAATGGGACC694156
1209453N/AN/A40374052TTGCTACTCCAAGTTT694157
1209466N/AN/A40704085AAGGCCCTTCTTGAAC624158
1209479N/AN/A42724287AGCACCCCGCCCAGGT734159
1209492N/AN/A43354350CCATGCCAAGTCTCCG874160
1209505N/AN/A43694384CAAAGAGGGATAGTGG924161
1209518N/AN/A46234638ACCCCTGGGCCTAAAG914162
1209531N/AN/A48064821CAAGCCCGTCCCACCT524163
1209544N/AN/A51515166TTCCTGTAGCCACACG504164
1209557N/AN/A54325447CGGCTGGCCGGAATCT464165
1209570N/AN/A57475762GGAGCCGCGGCCCCTG624166
1209583N/AN/A58765891CTCCCGAACCCCAATC524167
1209596N/AN/A61146129CTCTTCCCGTCCCCGC534168
1209609N/AN/A63626377ACCCAGTGATCAAAGG404169
1209622N/AN/A64406455CTCACAACCCATCAGG424170
1209635N/AN/A64776492AGGCCCTGGGATTCTA394171
1209648N/AN/A65446559GGAACCAAGAGCAAGT404172
1209661N/AN/A66326647CCATCCAGAGTCGCAG384173
1209674N/AN/A67126727CATAGGCAAGGAGGCT344174
1209687N/AN/A67996814AAGCTGCTCCAGGCGC574175
1209700N/AN/A68496864CGCCTTCTTCACACCC117 4176
1209713N/AN/A70597074GTGCCTGACGGCCTCG 684177
TABLE 66
Reduction of FXII RNA by 3-10-3 cEt gapmers with
uniform PS internucleoside linkages (Huh7,
electroporation, 2000 nM modified oligonucleotide)
SEQ IDSEQ IDSEQ IDSEQ ID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopSequenceFXIISEQ ID
NumberSiteSiteSiteSite(5′ to 3′)(% UTC)NO
1128802 218 23335693584TACATTTGTGGTACAG992426
11295312009202473977412GAGTTCCTGCGCCATC163837
1129947N/AN/A48374852TGCTTTCCGCACTCTC513554
1129948N/AN/A48404855ATCTGCTTTCCGCACT703630
1208266N/AN/A98113CACTCACCGAAAGTGT654178
1208297N/AN/A136151CCCCCAGAACAATCCT844179
1208332N/AN/A205220ATAGGCCTCCTAGTCA974180
1208366N/AN/A275290CCTTGTATCCACCCAG554181
1208397N/AN/A322337CCCGTTGTCTTCTTAA874182
1208431N/AN/A417432TAGCCTGCCACCGATC784183
1208459N/AN/A462477GAATCTACAAGGGAGA524184
1208492N/AN/A556571CCACCCAAGGGTTCCC814185
1208516N/AN/A609624TAGGCACTAGACTAGA974186
1208549N/AN/A635650CCATGGGCATAAGACC384187
1208578N/AN/A674689TGCCCTCAAGGATCAC464188
1208591N/AN/A740755AGCAGCACATATCTCA954189
1208604N/AN/A863878ATTGAAGGCCCTGGCC474190
1208617N/AN/A896911TGCCAGAGACAAGCTC434191
1208630N/AN/A934949CTCATAAGTGATAAAG584192
1208643N/AN/A977992TTGAAGCTTGGAGAAC524193
1208656N/AN/A10191034AAGAGGTTTACTGTTA764194
1208669N/AN/A10631078GATGGGCTGAATACCT514195
1208682N/AN/A11301145ACCCTTCATCTAAAAG564196
1208695N/AN/A11681183AGCTATGGCAGAGCTT984197
1208708N/AN/A15201535CCACACTCTAGGTAAA444198
1208721N/AN/A15751590ACCAAGTCAGGCCCAC924199
1208742N/AN/A16201635TTGGAATGTGCTGGGC584200
1208768N/AN/A16931708AGTTTGGGTAAGGCAA624201
1208796N/AN/A17591774AGATGGGATGGACGGA474202
1208820N/AN/A19241939TAGCTGAGCATGAAGT434203
1208847N/AN/A21132128ACTAGGACAGTAAATG504204
1208874N/AN/A21302145CCAAGGACCAAACCAG674205
1208899N/AN/A21692184AGCTTTTGCCACTATT904206
1208925N/AN/A21912206GGCACAAAGTACCTGC714207
1208951N/AN/A22692284GAGAATTGCCTGTGTC924208
1208977N/AN/A23252340TGTTTGCTAGTTCAAT274209
1209004N/AN/A23402355ACAGGAACCTAATACT744210
1209028N/AN/A24462461TGATGAATCAGCAACA594211
1209053N/AN/A24672482ATAGTGCCATCAGCTT504212
1209080N/AN/A24982513GTGTGTTAGACACTTG504213
1209105N/AN/A25702585AATGGCCTCTGAGCCT464214
1209131N/AN/A26502665ATTGAATGAGTGTCCT117 4215
1209159N/AN/A27112726GCACATTCCCAGTTAA494216
1209187N/AN/A27752790CCAAGTCAATACTTGA454217
1209210N/AN/A28042819GCCTACTTGCTGAATT354218
1209236N/AN/A28242839TGGTTCTACATTGAGA934219
1209258N/AN/A29032918TAACCACTCTGATCTG494220
1209284N/AN/A29652980AGGAAGAGCACTTGCC554221
1209309N/AN/A30303045AGTAGACTCCTGACTC494222
1209336N/AN/A33773392CTGCTCTAAAAGTTGG644223
1209350N/AN/A34623477CTCAACTGCTCAGGCA614224
1209363N/AN/A34923507ACAACACACTCTCTGA484225
1209376N/AN/A36073622GTCTTACCAGGGCTGA594226
1209389N/AN/A36703685CCTTGGACAGAAGGAC494227
1209402N/AN/A37073722CCTGCCCTATCACAGT924228
1209415N/AN/A38893904CCAGGAGAGTAATGAG494229
1209428N/AN/A39513966GGTATTGTGGAGGGAG564230
1209441N/AN/A40124027GTTTACCCACCTGCAA394231
1209454N/AN/A40384053CTTGCTACTCCAAGTT108 4232
1209467N/AN/A40734088GCCAAGGCCCTTCTTG564233
1209480N/AN/A42954310GCCCAGGGTTGCCCCT654234
1209493N/AN/A43364351ACCATGCCAAGTCTCC464235
1209506N/AN/A43704385ACAAAGAGGGATAGTG674236
1209519N/AN/A46254640CCACCCCTGGGCCTAA134 4237
1209532N/AN/A48074822GCAAGCCCGTCCCACC814238
1209545N/AN/A51525167GTTCCTGTAGCCACAC234239
1209558N/AN/A54355450GGCCGGCTGGCCGGAA844240
1209571N/AN/A57485763AGGAGCCGCGGCCCCT644241
1209584N/AN/A58785893TGCTCCCGAACCCCAA354242
1209597N/AN/A61206135CAAGCTCTCTTCCCGT534243
1209610N/AN/A63656380CTAACCCAGTGATCAA294244
1209623N/AN/A64436458ATTCTCACAACCCATC644245
1209636N/AN/A64866501GTGAATCCCAGGCCCT414246
1209649N/AN/A65536568CGCCCAGAGGGAACCA116 4247
1209662N/AN/A66336648CCCATCCAGAGTCGCA304248
1209675N/AN/A67136728TCATAGGCAAGGAGGC364249
1209688N/AN/A68006815AAAGCTGCTCCAGGCG274250
1209701N/AN/A68506865GCGCCTTCTTCACACC854251
1209714N/AN/A70637078ATTTGTGCCTGACGGC 534252
TABLE 67
Reduction of FXII RNA by 3-10-3 cEt gapmers with
uniform PS internucleoside linkages (Huh7,
electroporation, 2000 nM modified oligonucleotide)
SEQ IDSEQ IDSEQ IDSEQ ID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopSequenceFXIISEQ ID
NumberSiteSiteSiteSite(5′ to 3′)(% UTC)NO
1128802 218 23335693584TACATTTGTGGTACAG292426
11295312009202473977412GAGTTCCTGCGCCATC333837
1129948N/AN/A48404855ATCTGCTTTCCGCACT523630
1194288N/AN/A48384853CTGCTTTCCGCACTCT274253
1208267N/AN/A104119CCACAGCACTCACCGA128 4254
1208301N/AN/A137152CCCCCCAGAACAATCC177 4255
1208333N/AN/A213228CTTTCCACATAGGCCT684256
1208370N/AN/A276291CCCTTGTATCCACCCA414257
1208398N/AN/A331346CTACCTCCCCCCGTTG914258
1208432N/AN/A418433ATAGCCTGCCACCGAT116 4259
1208463N/AN/A465480GTGGAATCTACAAGGG344260
1208494N/AN/A557572CCCACCCAAGGGTTCC444261
1208519N/AN/A616631CACCAGGTAGGCACTA934262
1208550N/AN/A638653TGCCCATGGGCATAAG434263
1208579N/AN/A685700AGCCCATACCCTGCCC774264
1208592N/AN/A741756CAGCAGCACATATCTC644265
1208605N/AN/A864879CATTGAAGGCCCTGGC904266
1208618N/AN/A897912ATGCCAGAGACAAGCT564267
1208631N/AN/A935950GCTCATAAGTGATAAA544268
1208644N/AN/A10021017CAACCTGGTTTCACAG324269
1208657N/AN/A10201035TAAGAGGTTTACTGTT444270
1208670N/AN/A10661081GGTGATGGGCTGAATA524271
1208683N/AN/A11311146TACCCTTCATCTAAAA804272
1208696N/AN/A11691184GAGCTATGGCAGAGCT674273
1208709N/AN/A15291544TGCTATGTGCCACACT614274
1208722N/AN/A15781593CCCACCAAGTCAGGCC564275
1208744N/AN/A16211636GTTGGAATGTGCTGGG424276
1208771N/AN/A16941709AAGTTTGGGTAAGGCA814277
1208799N/AN/A17601775CAGATGGGATGGACGG574278
1208821N/AN/A20752090TTAAGATGCAAATGGG314279
1208848N/AN/A21152130GAACTAGGACAGTAAA404280
1208877N/AN/A21312146GCCAAGGACCAAACCA344281
1208901N/AN/A21702185AAGCTTTTGCCACTAT494282
1208926N/AN/A21922207TGGCACAAAGTACCTG734283
1208952N/AN/A22702285TGAGAATTGCCTGTGT594284
1208980N/AN/A23262341CTGTTTGCTAGTTCAA474285
1209005N/AN/A23422357TCACAGGAACCTAATA101 4286
1209031N/AN/A24472462TTGATGAATCAGCAAC394287
1209054N/AN/A24712486TGCTATAGTGCCATCA494288
1209081N/AN/A25172532GCTACCTTAGGGAGAA484289
1209108N/AN/A25722587GAAATGGCCTCTGAGC304290
1209134N/AN/A26572672CTCTCCTATTGAATGA184291
1209160N/AN/A27132728TTGCACATTCCCAGTT344292
1209188N/AN/A27762791CCCAAGTCAATACTTG434293
1209212N/AN/A28052820TGCCTACTTGCTGAAT874294
1209238N/AN/A28252840CTGGTTCTACATTGAG204295
1209261N/AN/A29052920GTTAACCACTCTGATC794296
1209285N/AN/A29853000AAGTCTTCAGTCCCAA474297
1209312N/AN/A30333048TGGAGTAGACTCCTGA724298
1209337N/AN/A34133428ACCCTCAAAAAGGTCG454299
1209351N/AN/A34633478ACTCAACTGCTCAGGC874300
1209364N/AN/A34933508GACAACACACTCTCTG444301
1209377N/AN/A36083623AGTCTTACCAGGGCTG884302
1209390N/AN/A36733688GTTCCTTGGACAGAAG964303
1209403N/AN/A37093724ACCCTGCCCTATCACA294304
1209416N/AN/A38903905ACCAGGAGAGTAATGA314305
1209429N/AN/A39543969AAGGGTATTGTGGAGG454306
1209442N/AN/A40164031CTTGGTTTACCCACCT494307
1209455N/AN/A40414056GACCTTGCTACTCCAA214308
1209468N/AN/A40744089GGCCAAGGCCCTTCTT128 4309
1209481N/AN/A42984313TAGGCCCAGGGTTGCC135 4310
1209494N/AN/A43374352GACCATGCCAAGTCTC404311
1209507N/AN/A45284543GTTCCCAACCATCTGC424312
1209520N/AN/A46314646AGTGAGCCACCCCTGG914313
1209533N/AN/A48134828TTCCTGGCAAGCCCGT604314
1209546N/AN/A51565171CCGGGTTCCTGTAGCC584315
1209559N/AN/A54375452GCGGCCGGCTGGCCGG564316
1209572N/AN/A57495764GAGGAGCCGCGGCCCC404317
1209585N/AN/A58795894CTGCTCCCGAACCCCA484318
1209598N/AN/A61216136CCAAGCTCTCTTCCCG614319
1209611N/AN/A63666381CCTAACCCAGTGATCA484320
1209624N/AN/A64536468TCACCTACACATTCTC374321
1209637N/AN/A64876502AGTGAATCCCAGGCCC138 4322
1209650N/AN/A65546569GCGCCCAGAGGGAACC504323
1209663N/AN/A66356650CACCCATCCAGAGTCG514324
1209676N/AN/A67146729TTCATAGGCAAGGAGG454325
1209689N/AN/A68036818GACAAAGCTGCTCCAG994326
1209702N/AN/A68646879CCTGCGAACACAGAGC434327
1209715N/AN/A70677082TGAGATTTGTGCCTGA 444328
TABLE 68
Reduction of FXII RNA by 3-10-3 cEt gapmers with
uniform PS internucleoside linkages (Huh7,
electroporation, 2000 nM modified oligonucleotide)
SEQ IDSEQ IDSEQ IDSEQ ID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopSequenceFXIISEQ ID
NumberSiteSiteSiteSite(5′ to 3′)(% UTC)NO
1128802 218 23335693584TACATTTGTGGTACAG372426
11295312009202473977412GAGTTCCTGCGCCATC253837
1129948N/AN/A48404855ATCTGCTTTCCGCACT443630
1194289N/AN/A48394854TCTGCTTTCCGCACTC284329
1208271N/AN/A116131CAATCCTGGTTCCCAC684330
1208302N/AN/A154169CATGGCTGTGATAGCG734331
1208337N/AN/A215230ACCTTTCCACATAGGC814332
1208371N/AN/A278293TGCCCTTGTATCCACC434333
1208402N/AN/A342357CCAAACCCTTTCTACC594334
1208435N/AN/A419434CATAGCCTGCCACCGA294335
1208464N/AN/A467482AGGTGGAATCTACAAG384336
1208497N/AN/A558573CCCCACCCAAGGGTTC684337
1208520N/AN/A617632GCACCAGGTAGGCACT444338
1208554N/AN/A646661CACTCTAGTGCCCATG111 4339
1208580N/AN/A695710ACTTAGACACAGCCCA434340
1208593N/AN/A745760GCGCCAGCAGCACATA554341
1208606N/AN/A865880CCATTGAAGGCCCTGG394342
1208619N/AN/A898913GATGCCAGAGACAAGC264343
1208632N/AN/A936951AGCTCATAAGTGATAA734344
1208645N/AN/A10051020TATCAACCTGGTTTCA474345
1208658N/AN/A10211036CTAAGAGGTTTACTGT354346
1208671N/AN/A10721087GCACCAGGTGATGGGC404347
1208684N/AN/A11331148GGTACCCTTCATCTAA121 4348
1208697N/AN/A12001215ATTTAGTGTCTGGAAG414349
1208710N/AN/A15411556GTTCACAGGCCCTGCT554350
1208723N/AN/A15791594CCCCACCAAGTCAGGC954351
1208745N/AN/A16241639AGGGTTGGAATGTGCT444352
1208773N/AN/A16971712ACCAAGTTTGGGTAAG394353
1208800N/AN/A17621777TGCAGATGGGATGGAC514354
1208824N/AN/A20802095GACCTTTAAGATGCAA404355
1208851N/AN/A21162131AGAACTAGGACAGTAA334356
1208878N/AN/A21332148TTGCCAAGGACCAAAC364357
1208902N/AN/A21712186TAAGCTTTTGCCACTA294358
1208929N/AN/A21932208CTGGCACAAAGTACCT584359
1208955N/AN/A22712286ATGAGAATTGCCTGTG294360
1208981N/AN/A23272342ACTGTTTGCTAGTTCA444361
1209008N/AN/A23752390CTGTTGGTTGATGAAA834362
1209032N/AN/A24482463ATTGATGAATCAGCAA684363
1209057N/AN/A24722487GTGCTATAGTGCCATC254364
1209084N/AN/A25182533GGCTACCTTAGGGAGA574365
1209109N/AN/A25792594GCTTTTGGAAATGGCC274366
1209135N/AN/A26732688CTGCTGCTTGTTTCAG824367
1209163N/AN/A27162731AATTTGCACATTCCCA714368
1209191N/AN/A27772792TCCCAAGTCAATACTT774369
1209213N/AN/A28082823ATGTGCCTACTTGCTG584370
1209240N/AN/A28272842CTCTGGTTCTACATTG384371
1209262N/AN/A29062921TGTTAACCACTCTGAT106 4372
1209288N/AN/A29863001TAAGTCTTCAGTCCCA334373
1209313N/AN/A30423057TCAGATAGCTGGAGTA824374
1209339N/AN/A34143429GACCCTCAAAAAGGTC764375
1209352N/AN/A34643479TACTCAACTGCTCAGG474376
1209365N/AN/A34943509GGACAACACACTCTCT734377
1209378N/AN/A36113626CGTAGTCTTACCAGGG274378
1209391N/AN/A36783693GCAGAGTTCCTTGGAC224379
1209404N/AN/A37133728GCCCACCCTGCCCTAT834380
1209417N/AN/A38913906TACCAGGAGAGTAATG344381
1209430N/AN/A39553970AAAGGGTATTGTGGAG194382
1209443N/AN/A40204035CAAGCTTGGTTTACCC484383
1209456N/AN/A40534068TACTTGCCTTGTGACC424384
1209469N/AN/A40754090GGGCCAAGGCCCTTCT514385
1209482N/AN/A42994314GTAGGCCCAGGGTTGC334386
1209495N/AN/A43404355TAGGACCATGCCAAGT394387
1209508N/AN/A45304545CCGTTCCCAACCATCT604388
1209521N/AN/A46384653GGAACGCAGTGAGCCA734389
1209534N/AN/A48144829CTTCCTGGCAAGCCCG454390
1209547N/AN/A51615176GTTGTCCGGGTTCCTG394391
1209560N/AN/A54395454CCGCGGCCGGCTGGCC424392
1209573N/AN/A57565771GGAGACGGAGGAGCCG714393
1209586N/AN/A58855900AGCCCCCTGCTCCCGA504394
1209599N/AN/A61266141GGGCCCCAAGCTCTCT304395
1209612N/AN/A63726387CTTCCGCCTAACCCAG364396
1209625N/AN/A64566471GATTCACCTACACATT404397
1209638N/AN/A64906505AGCAGTGAATCCCAGG354398
1209651N/AN/A65696584GGCCTTTGCAGCCCGG584399
1209664N/AN/A66366651CCACCCATCCAGAGTC734400
1209677N/AN/A67306745GTGCCATTAATTCAAT614401
1209690N/AN/A68046819GGACAAAGCTGCTCCA754402
1209703N/AN/A68686883CGCCCCTGCGAACACA274403
1209716N/AN/A70687083CTGAGATTTGTGCCTG 254404
TABLE 69
Reduction of FXII RNA by 3-10-3 cEt gapmers with
uniform PS internucleoside linkages (Huh7,
electroporation, 2000 nM modified oligonucleotide)
SEQ IDSEQ IDSEQ IDSEQ ID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopSequenceFXIISEQ ID
NumberSiteSiteSiteSite(5′ to 3′)(% UTC)NO
1128802 218 23335693584TACATTTGTGGTACAG982426
11295312009202473977412GAGTTCCTGCGCCATC133837
1129948N/AN/A48404855ATCTGCTTTCCGCACT713630
1194290N/AN/A48414856CATCTGCTTTCCGCAC444405
1208272N/AN/A117132ACAATCCTGGTTCCCA404406
1208307N/AN/A177192GGTCATGAGCAGAGGC584407
1208338N/AN/A217232TCACCTTTCCACATAG594408
1208375N/AN/A301316ATCTCCCCCAGAAATG404409
1208403N/AN/A343358CCCAAACCCTTTCTAC864410
1208436N/AN/A421436GTCATAGCCTGCCACC724411
1208468N/AN/A468483AAGGTGGAATCTACAA474412
1208498N/AN/A560575ATCCCCACCCAAGGGT534413
1208524N/AN/A618633AGCACCAGGTAGGCAC494414
1208555N/AN/A648663ATCACTCTAGTGCCCA111 4415
1208581N/AN/A696711CACTTAGACACAGCCC834416
1208594N/AN/A834849AATGATGCCCATGAGA404417
1208607N/AN/A868883TGCCCATTGAAGGCCC604418
1208620N/AN/A906921GGCATTCAGATGCCAG108 4419
1208633N/AN/A937952CAGCTCATAAGTGATA554420
1208646N/AN/A10061021TTATCAACCTGGTTTC574421
1208659N/AN/A10251040AACCCTAAGAGGTTTA404422
1208672N/AN/A10731088TGCACCAGGTGATGGG534423
1208685N/AN/A11351150CAGGTACCCTTCATCT514424
1208698N/AN/A12021217TAATTTAGTGTCTGGA894425
1208711N/AN/A15471562CATCTGGTTCACAGGC534426
1208724N/AN/A15801595ACCCCACCAAGTCAGG106 4427
1208748N/AN/A16251640CAGGGTTGGAATGTGC884428
1208775N/AN/A16981713CACCAAGTTTGGGTAA934429
1208802N/AN/A17631778ATGCAGATGGGATGGA414430
1208825N/AN/A20812096GGACCTTTAAGATGCA444431
1208852N/AN/A21172132CAGAACTAGGACAGTA904432
1208881N/AN/A21342149CTTGCCAAGGACCAAA844433
1208905N/AN/A21722187ATAAGCTTTTGCCACT664434
1208930N/AN/A22072222ATGCTGAGCAGTGTCT304435
1208956N/AN/A22772292CGAATAATGAGAATTG734436
1208984N/AN/A23282343TACTGTTTGCTAGTTC814437
1209009N/AN/A23782393ATGCTGTTGGTTGATG394438
1209035N/AN/A24512466AGCATTGATGAATCAG117 4439
1209058N/AN/A24732488TGTGCTATAGTGCCAT111 4440
1209085N/AN/A25222537AGAAGGCTACCTTAGG794441
1209111N/AN/A25802595GGCTTTTGGAAATGGC624442
1209137N/AN/A26982713TAAGGTTCAACAAGGC444443
1209166N/AN/A27172732AAATTTGCACATTCCC864444
1209192N/AN/A27782793CTCCCAAGTCAATACT105 4445
1209215N/AN/A28102825GAATGTGCCTACTTGC424446
1209241N/AN/A28512866ATAGTACAGTTGATCC404447
1209265N/AN/A29082923ACTGTTAACCACTCTG574448
1209289N/AN/A29883003GGTAAGTCTTCAGTCC464449
1209316N/AN/A30433058GTCAGATAGCTGGAGT944450
1209340N/AN/A34153430AGACCCTCAAAAAGGT404451
1209353N/AN/A34653480GTACTCAACTGCTCAG574452
1209366N/AN/A34963511AGGGACAACACACTCT354453
1209379N/AN/A36253640CTCCAACTCCTCTGCG614454
1209392N/AN/A36813696CAAGCAGAGTTCCTTG624455
1209405N/AN/A37453760GACAAGGCTTCCCTGC106 4456
1209418N/AN/A38923907ATACCAGGAGAGTAAT514457
1209431N/AN/A39593974TTCCAAAGGGTATTGT414458
1209444N/AN/A40214036CCAAGCTTGGTTTACC904459
1209457N/AN/A40544069CTACTTGCCTTGTGAC424460
1209470N/AN/A41264141GAGAGATGGACATGGT444461
1209483N/AN/A43014316CTGTAGGCCCAGGGTT444462
1209496N/AN/A43414356CTAGGACCATGCCAAG844463
1209509N/AN/A45314546CCCGTTCCCAACCATC114 4464
1209522N/AN/A46404655AGGGAACGCAGTGAGC744465
1209535N/AN/A48334848TTCCGCACTCTCCCTC814466
1209548N/AN/A51625177CGTTGTCCGGGTTCCT114467
1209561N/AN/A54415456GCCCGCGGCCGGCTGG394468
1209574N/AN/A57575772GGGAGACGGAGGAGCC764469
1209587N/AN/A58865901AAGCCCCCTGCTCCCG994470
1209600N/AN/A61736188GCAACAGAGCTAACCC524471
1209613N/AN/A63746389TTCTTCCGCCTAACCC314472
1209626N/AN/A64606475CTGGGATTCACCTACA584473
1209639N/AN/A64916506CAGCAGTGAATCCCAG664474
1209652N/AN/A65746589TAGTTGGCCTTTGCAG334475
1209665N/AN/A66376652ACCACCCATCCAGAGT544476
1209678N/AN/A67366751GAGGAGGTGCCATTAA374477
1209691N/AN/A68056820TGGACAAAGCTGCTCC574478
1209704N/AN/A68696884CCGCCCCTGCGAACAC484479
1209717N/AN/A70697084CCTGAGATTTGTGCCT 884480
TABLE 70
Reduction of FXII RNA by 3-10-3 cEt gapmers with uniform
PS internucleoside linkages (Huh7, electroporation,
2000 nM modified oligonucleotide)
SEQ IDSEQ IDSEQ IDSEQ ID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopSequenceFXIISEQ ID
NumberSiteSiteSiteSite(5′ to 3′)(% UTC)NO
1128802 218 23335693584TACATTTGTGGTACAG992426
11295312009202473977412GAGTTCCTGCGCCATC113837
1129948N/AN/A48404855ATCTGCTTTCCGCACT433630
1194291N/AN/A48424857TCATCTGCTTTCCGCA554481
1208276N/AN/A118133GACAATCCTGGTTCCC814482
1208310N/AN/A182197CCACAGGTCATGAGCA444483
1208342N/AN/A231246CTTCCGGGCTGGCCTC104 4484
1208376N/AN/A309324TAAGGCCCATCTCCCC117 4485
1208407N/AN/A349364CCAAGACCCAAACCCT604486
1208438N/AN/A424439TAAGTCATAGCCTGCC714487
1208469N/AN/A471486CCCAAGGTGGAATCTA924488
1208500N/AN/A570585CACCATACACATCCCC444489
1208525N/AN/A620635CTAGCACCAGGTAGGC524490
1208559N/AN/A650665CGATCACTCTAGTGCC694491
1208582N/AN/A698713GGCACTTAGACACAGC614492
1208595N/AN/A835850GAATGATGCCCATGAG654493
1208608N/AN/A869884TTGCCCATTGAAGGCC614494
1208621N/AN/A907922AGGCATTCAGATGCCA434495
1208634N/AN/A951966CGCCCAGAGTCACCCA584496
1208647N/AN/A10071022GTTATCAACCTGGTTT764497
1208660N/AN/A10261041CAACCCTAAGAGGTTT834498
1208673N/AN/A10741089ATGCACCAGGTGATGG484499
1208686N/AN/A11401155AATGGCAGGTACCCTT644500
1208699N/AN/A12051220AGGTAATTTAGTGTCT964501
1208712N/AN/A15501565GTCCATCTGGTTCACA694502
1208725N/AN/A15811596AACCCCACCAAGTCAG554503
1208749N/AN/A16291644AGTCCAGGGTTGGAAT454504
1208777N/AN/A17001715GGCACCAAGTTTGGGT724505
1208803N/AN/A17661781AAGATGCAGATGGGAT994506
1208828N/AN/A20832098ATGGACCTTTAAGATG584507
1208855N/AN/A21182133CCAGAACTAGGACAGT704508
1208882N/AN/A21352150ACTTGCCAAGGACCAA404509
1208906N/AN/A21732188AATAAGCTTTTGCCAC694510
1208932N/AN/A22082223AATGCTGAGCAGTGTC964511
1208959N/AN/A22782293GCGAATAATGAGAATT504512
1208985N/AN/A23292344ATACTGTTTGCTAGTT814513
1209012N/AN/A23792394TATGCTGTTGGTTGAT544514
1209036N/AN/A24532468TTAGCATTGATGAATC504515
1209061N/AN/A24822497ATTCAGGTGTGTGCTA474516
1209088N/AN/A25282543AGCACAAGAAGGCTAC574517
1209112N/AN/A25872602GGGATTTGGCTTTTGG764518
1209140N/AN/A26992714TTAAGGTTCAACAAGG644519
1209169N/AN/A27232738AGTGAAAAATTTGCAC704520
1209195N/AN/A27792794ACTCCCAAGTCAATAC884521
1209216N/AN/A28112826AGAATGTGCCTACTTG374522
1209243N/AN/A28532868TAATAGTACAGTTGAT464523
1209266N/AN/A29092924CACTGTTAACCACTCT844524
1209292N/AN/A29903005TGGGTAAGTCTTCAGT624525
1209317N/AN/A30443059AGTCAGATAGCTGGAG944526
1209341N/AN/A34163431CAGACCCTCAAAAAGG644527
1209354N/AN/A34673482CTGTACTCAACTGCTC474528
1209367N/AN/A34973512CAGGGACAACACACTC614529
1209380N/AN/A36483663GGTACATGTCTCCCAG424530
1209393N/AN/A36823697CCAAGCAGAGTTCCTT744531
1209406N/AN/A37583773ACCTGTAGAAAGAGAC414532
1209419N/AN/A38933908GATACCAGGAGAGTAA704533
1209432N/AN/A39603975CTTCCAAAGGGTATTG794534
1209445N/AN/A40224037TCCAAGCTTGGTTTAC994535
1209458N/AN/A40554070CCTACTTGCCTTGTGA674536
1209471N/AN/A41304145GTCTGAGAGATGGACA544537
1209484N/AN/A43054320TATTCTGTAGGCCCAG384538
1209497N/AN/A43424357TCTAGGACCATGCCAA694539
1209510N/AN/A45334548GGCCCGTTCCCAACCA454540
1209523N/AN/A46414656GAGGGAACGCAGTGAG120 4541
1209536N/AN/A48344849TTTCCGCACTCTCCCT784542
1209549N/AN/A53825397CCCCCCACTTCCTAAC514543
1209562N/AN/A54425457AGCCCGCGGCCGGCTG824544
1209575N/AN/A57615776CGCTGGGAGACGGAGG314545
1209588N/AN/A59135928TCAGACCTGGCCACAA454546
1209601N/AN/A63266341CCTAGCAGTTGTGCCT704547
1209614N/AN/A64046419GGCACCCGGAACGATA534548
1209627N/AN/A64616476CCTGGGATTCACCTAC514549
1209640N/AN/A64946509TCCCAGCAGTGAATCC494550
1209653N/AN/A65756590CTAGTTGGCCTTTGCA524551
1209666N/AN/A66386653CACCACCCATCCAGAG474552
1209679N/AN/A67586773CTCTCGCAGCAAGCCC524553
1209692N/AN/A68066821ATGGACAAAGCTGCTC294554
1209705N/AN/A68726887CCTCCGCCCCTGCGAA604555
1209718N/AN/A70707085ACCTGAGATTTGTGCC 654556
TABLE 71
Reduction of FXII RNA by 3-10-3 cEt gapmers with
uniform PS internucleoside linkages (Huh7,
electroporation, 2000 nM modified oligonucleotide)
SEQ IDSEQ IDSEQ IDSEQ ID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopSequenceFXIISEQ ID
NumberSiteSiteSiteSite(5′ to 3′)(% UTC)NO
1128802 218 23335693584TACATTTGTGGTACAG352426
11295312009202473977412GAGTTCCTGCGCCATC143837
1129948N/AN/A48404855ATCTGCTTTCCGCACT313630
1194292N/AN/A48434858CTCATCTGCTTTCCGC654557
1208277N/AN/A121136TGGGACAATCCTGGTT924558
1208312N/AN/A183198CCCACAGGTCATGAGC634559
1208347N/AN/A233248GCCTTCCGGGCTGGCC574560
1208378N/AN/A310325TTAAGGCCCATCTCCC111 4561
1208408N/AN/A358373GATTTCTTCCCAAGAC494562
1208439N/AN/A430445TGACTATAAGTCATAG434563
1208473N/AN/A472487TCCCAAGGTGGAATCT754564
1208502N/AN/A572587TGCACCATACACATCC594565
1208529N/AN/A621636CCTAGCACCAGGTAGG404566
1208562N/AN/A651666ACGATCACTCTAGTGC784567
1208583N/AN/A717732GCTCCGAGCCAGGCTC814568
1208596N/AN/A836851TGAATGATGCCCATGA414569
1208609N/AN/A872887TCCTTGCCCATTGAAG724570
1208622N/AN/A909924AGAGGCATTCAGATGC109 4571
1208635N/AN/A952967TCGCCCAGAGTCACCC554572
1208648N/AN/A10081023TGTTATCAACCTGGTT424573
1208661N/AN/A10361051CCCTTCTCAACAACCC764574
1208674N/AN/A10761091CCATGCACCAGGTGAT524575
1208687N/AN/A11411156AAATGGCAGGTACCCT103 4576
1208700N/AN/A12091224ATGTAGGTAATTTAGT764577
1208713N/AN/A15521567AGGTCCATCTGGTTCA844578
1208726N/AN/A15821597CAACCCCACCAAGTCA454579
1208752N/AN/A16301645GAGTCCAGGGTTGGAA264580
1208779N/AN/A17031718TAGGGCACCAAGTTTG274581
1208805N/AN/A19131928GAAGTTGTGTGCCTGT644582
1208829N/AN/A20852100AGATGGACCTTTAAGA344583
1208856N/AN/A21192134ACCAGAACTAGGACAG574584
1208884N/AN/A21362151CACTTGCCAAGGACCA474585
1208909N/AN/A21742189CAATAAGCTTTTGCCA784586
1208933N/AN/A22142229CCATGAAATGCTGAGC294587
1208960N/AN/A22862301TAACCATCGCGAATAA524588
1208988N/AN/A23312346TAATACTGTTTGCTAG484589
1209013N/AN/A23842399GATTATATGCTGTTGG824590
1209039N/AN/A24542469CTTAGCATTGATGAAT514591
1209064N/AN/A24842499TGATTCAGGTGTGTGC754592
1209089N/AN/A25372552TAGTTCCTAAGCACAA324593
1209115N/AN/A26142629CGTTTTTCACACTTTG404594
1209142N/AN/A27012716AGTTAAGGTTCAACAA554595
1209170N/AN/A27252740GCAGTGAAAAATTTGC624596
1209196N/AN/A27802795AACTCCCAAGTCAATA304597
1209219N/AN/A28122827GAGAATGTGCCTACTT404598
1209244N/AN/A28642879AACGGCAGTAATAATA694599
1209269N/AN/A29142929GAAGTCACTGTTAACC654600
1209293N/AN/A29933008CCTTGGGTAAGTCTTC864601
1209320N/AN/A30503065TTCAGGAGTCAGATAG874602
1209342N/AN/A34193434GGACAGACCCTCAAAA544603
1209355N/AN/A34683483CCTGTACTCAACTGCT364604
1209368N/AN/A34983513GCAGGGACAACACACT534605
1209381N/AN/A36503665AGGGTACATGTCTCCC934606
1209394N/AN/A36843699CTCCAAGCAGAGTTCC564607
1209407N/AN/A37603775ACACCTGTAGAAAGAG584608
1209420N/AN/A38943909TGATACCAGGAGAGTA614609
1209433N/AN/A39613976ACTTCCAAAGGGTATT264610
1209446N/AN/A40234038TTCCAAGCTTGGTTTA484611
1209459N/AN/A40564071ACCTACTTGCCTTGTG314612
1209472N/AN/A41314146GGTCTGAGAGATGGAC414613
1209485N/AN/A43074322CCTATTCTGTAGGCCC714614
1209498N/AN/A43464361AGAGTCTAGGACCATG504615
1209511N/AN/A45774592ACCACCCGGCCTCCTG714616
1209524N/AN/A46424657GGAGGGAACGCAGTGA113 4617
1209537N/AN/A49094924TTGCCTTGGTGTCTGA404618
1209550N/AN/A53835398CCCCCCCACTTCCTAA684619
1209563N/AN/A54445459AGAGCCCGCGGCCGGC794620
1209576N/AN/A57675782AAGCTGCGCTGGGAGA434621
1209589N/AN/A59185933CGCTCTCAGACCTGGC794622
1209602N/AN/A63366351TACCCCTGCCCCTAGC514623
1209615N/AN/A64116426TTCTGTAGGCACCCGG494624
1209628N/AN/A64656480TCTACCTGGGATTCAC844625
1209641N/AN/A64956510ATCCCAGCAGTGAATC111 4626
1209654N/AN/A66016616CTAGCCCGGAGCGCGG664627
1209667N/AN/A66606675GCGGAAACAGAAACCC494628
1209680N/AN/A67646779CTTCCTCTCTCGCAGC604629
1209693N/AN/A68076822GATGGACAAAGCTGCT874630
1209706N/AN/A68756890ATTCCTCCGCCCCTGC764631
1209719N/AN/A70717086GACCTGAGATTTGTGC 984632
TABLE 72
Reduction of FXII RNA by 3-10-3 cEt gapmers with
uniform PS internucleoside linkages (Huh7,
electroporation, 2000 nM modified oligonucleotide)
SEQ IDSEQ IDSEQ IDSEQ ID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopSequenceFXIISEQ ID
NumberSiteSiteSiteSite(5′ to 3′)(% UTC)NO
1128802 218 23335693584TACATTTGTGGTACAG202426
11295312009202473977412GAGTTCCTGCGCCATC 83837
1129948N/AN/A48404855ATCTGCTTTCCGCACT213630
1129949N/AN/A48444859TCTCATCTGCTTTCCG273706
1208281N/AN/A122137CTGGGACAATCCTGGT104 4633
1208314N/AN/A184199ACCCACAGGTCATGAG284634
1208349N/AN/A234249GGCCTTCCGGGCTGGC594635
1208379N/AN/A311326CTTAAGGCCCATCTCC374636
1208412N/AN/A398413TGCTAGTCTGCAGCTT354637
1208443N/AN/A431446CTGACTATAAGTCATA474638
1208476N/AN/A517532CCGACTGTGTGCTCTT134639
1208504N/AN/A573588CTGCACCATACACATC274640
1208530N/AN/A622637ACCTAGCACCAGGTAG854641
1208564N/AN/A656671AGCTCACGATCACTCT864642
1208584N/AN/A718733TGCTCCGAGCCAGGCT454643
1208597N/AN/A837852ATGAATGATGCCCATG354644
1208610N/AN/A878893GATCCTTCCTTGCCCA274645
1208623N/AN/A913928CTTCAGAGGCATTCAG654646
1208636N/AN/A954969CCTCGCCCAGAGTCAC109 4647
1208649N/AN/A10111026TACTGTTATCAACCTG404648
1208662N/AN/A10461061ACATGGGTTTCCCTTC524649
1208675N/AN/A10781093TTCCATGCACCAGGTG344650
1208688N/AN/A11421157GAAATGGCAGGTACCC474651
1208701N/AN/A12101225CATGTAGGTAATTTAG214652
1208714N/AN/A15541569TAAGGTCCATCTGGTT924653
1208729N/AN/A15841599CTCAACCCCACCAAGT794654
1208753N/AN/A16671682AAACTTTTGGGTGTGG354655
1208782N/AN/A17051720GATAGGGCACCAAGTT854656
1208806N/AN/A19151930ATGAAGTTGTGTGCCT484657
1208832N/AN/A20862101GAGATGGACCTTTAAG384658
1208859N/AN/A21222137CAAACCAGAACTAGGA584659
1208887N/AN/A21422157AAAGTGCACTTGCCAA294660
1208910N/AN/A21752190TCAATAAGCTTTTGCC314661
1208936N/AN/A22152230GCCATGAAATGCTGAG244662
1208963N/AN/A22942309ATAGAACATAACCATC354663
1208989N/AN/A23332348CCTAATACTGTTTGCT214664
1209016N/AN/A23852400AGATTATATGCTGTTG234665
1209040N/AN/A24552470GCTTAGCATTGATGAA514666
1209065N/AN/A24862501CTTGATTCAGGTGTGT314667
1209092N/AN/A25382553GTAGTTCCTAAGCACA484668
1209118N/AN/A26302645AGTCTACTTAGTGCAA394669
1209144N/AN/A27022717CAGTTAAGGTTCAACA264670
1209173N/AN/A27442759ATTTGTGGGCATGCAC574671
1209199N/AN/A27812796TAACTCCCAAGTCAAT494672
1209220N/AN/A28132828TGAGAATGTGCCTACT244673
1209246N/AN/A28652880AAACGGCAGTAATAAT594674
1209270N/AN/A29172932GTTGAAGTCACTGTTA234675
1209296N/AN/A30133028ACAACCTGCTAGCTGT734676
1209321N/AN/A30513066GTTCAGGAGTCAGATA574677
1209343N/AN/A34213436AAGGACAGACCCTCAA604678
1209356N/AN/A34703485CCCCTGTACTCAACTG644679
1209369N/AN/A34993514TGCAGGGACAACACAC824680
1209382N/AN/A36513666CAGGGTACATGTCTCC394681
1209395N/AN/A36863701CTCTCCAAGCAGAGTT744682
1209408N/AN/A37623777GCACACCTGTAGAAAG544683
1209421N/AN/A38963911GGTGATACCAGGAGAG564684
1209434N/AN/A39623977GACTTCCAAAGGGTAT574685
1209447N/AN/A40254040GTTTCCAAGCTTGGTT554686
1209460N/AN/A40574072AACCTACTTGCCTTGT284687
1209473N/AN/A42424257CACCTTTCTGGCAGTG564688
1209486N/AN/A43174332TATCCAGCAACCTATT454689
1209499N/AN/A43514366TCAGGAGAGTCTAGGA424690
1209512N/AN/A45794594ACACCACCCGGCCTCC304691
1209525N/AN/A46574672GTGCGGCAGGCTTGGG274692
1209538N/AN/A50775092CCCACGCGGCGCACCG574693
1209551N/AN/A54045419GCCCTCTCGGCTCCTC334694
1209564N/AN/A54455460GAGAGCCCGCGGCCGG604695
1209577N/AN/A57715786GTGGAAGCTGCGCTGG304696
1209590N/AN/A59195934GCGCTCTCAGACCTGG111 4697
1209603N/AN/A63526367CAAAGGTCTCCTCCCC544698
1209616N/AN/A64146429CCATTCTGTAGGCACC254699
1209629N/AN/A64686483GATTCTACCTGGGATT704700
1209642N/AN/A64966511GATCCCAGCAGTGAAT744701
1209655N/AN/A66076622CCCACACTAGCCCGGA804702
1209668N/AN/A66616676AGCGGAAACAGAAACC834703
1209681N/AN/A67666781CCCTTCCTCTCTCGCA674704
1209694N/AN/A68086823CGATGGACAAAGCTGC404705
1209707N/AN/A70147029ACCTGGCACGCATCGG 104706
1209720N/AN/A70737088TGGACCTGAGATTTGT 444707
TABLE 73
Reduction of FXII RNA by 3-10-3 cEt gapmers with
uniform PS internucleoside linkages (Huh7,
electroporation, 2000 nM modified oligonucleotide)
SEQ IDSEQ IDSEQ IDSEQ ID
NO: 1NO: 1NO: 2NO: 2
CompoundStartStopStartStopSequenceFXIISEQ ID
NumberSiteSiteSiteSite(5′ to 3′)(% UTC)NO
1128802 218 23335693584TACATTTGTGGTACAG422426
11295312009202473977412GAGTTCCTGCGCCATC123837
1129948N/AN/A48404855ATCTGCTTTCCGCACT253630
1194293N/AN/A48454860CTCTCATCTGCTTTCC464708
1208282N/AN/A124139TCCTGGGACAATCCTG944709
1208317N/AN/A185200GACCCACAGGTCATGA414710
1208351N/AN/A265280ACCCAGTCTGGTTGTC544711
1208382N/AN/A312327TCTTAAGGCCCATCTC784712
1208413N/AN/A399414TTGCTAGTCTGCAGCT224713
1208444N/AN/A432447ACTGACTATAAGTCAT794714
1208478N/AN/A518533ACCGACTGTGTGCTCT264715
1208506N/AN/A576591ACACTGCACCATACAC184716
1208534N/AN/A625640AAGACCTAGCACCAGG254717
1208566N/AN/A657672CAGCTCACGATCACTC404718
1208585N/AN/A721736ACCTGCTCCGAGCCAG794719
1208598N/AN/A838853CATGAATGATGCCCAT364720
1208611N/AN/A881896CTTGATCCTTCCTTGC394721
1208624N/AN/A914929GCTTCAGAGGCATTCA454722
1208637N/AN/A961976TCAAATCCCTCGCCCA634723
1208650N/AN/A10121027TTACTGTTATCAACCT344724
1208663N/AN/A10481063TCACATGGGTTTCCCT304725
1208676N/AN/A10801095ATTTCCATGCACCAGG105 4726
1208689N/AN/A11431158GGAAATGGCAGGTACC264727
1208702N/AN/A12111226GCATGTAGGTAATTTA444728
1208715N/AN/A15631578CCACCAGGGTAAGGTC304729
1208730N/AN/A15851600ACTCAACCCCACCAAG143 4730
1208756N/AN/A16691684AGAAACTTTTGGGTGT554731
1208784N/AN/A17061721GGATAGGGCACCAAGT110 4732
1208808N/AN/A19181933AGCATGAAGTTGTGTG684733
1208833N/AN/A20872102TGAGATGGACCTTTAA634734
1208860N/AN/A21232138CCAAACCAGAACTAGG264735
1208888N/AN/A21442159GCAAAGTGCACTTGCC794736
1208913N/AN/A21772192GCTCAATAAGCTTTTG294737
1208937N/AN/A22162231TGCCATGAAATGCTGA324738
1208964N/AN/A23162331GTTCAATGTTCACTGT314739
1208992N/AN/A23342349ACCTAATACTGTTTGC594740
1209017N/AN/A23862401CAGATTATATGCTGTT184741
1209043N/AN/A24562471AGCTTAGCATTGATGA384742
1209068N/AN/A24882503CACTTGATTCAGGTGT664743
1209093N/AN/A25392554TGTAGTTCCTAAGCAC354744
1209119N/AN/A26332648CTCAGTCTACTTAGTG164745
1209147N/AN/A27042719CCCAGTTAAGGTTCAA404746
1209174N/AN/A27452760CATTTGTGGGCATGCA414747
1209200N/AN/A27822797GTAACTCCCAAGTCAA644748
1209247N/AN/A28682883GTAAAACGGCAGTAAT564749
1209273N/AN/A29242939GTTGAATGTTGAAGTC534750
1209297N/AN/A30143029CACAACCTGCTAGCTG364751
1209324N/AN/A30593074AAACTTGGGTTCAGGA434752
1209344N/AN/A34223437AAAGGACAGACCCTCA554753
1209357N/AN/A34713486TCCCCTGTACTCAACT123 4754
1209370N/AN/A35013516ACTGCAGGGACAACAC264755
1209383N/AN/A36543669AGGCAGGGTACATGTC554756
1209396N/AN/A37003715TATCACAGTCCCCTCT454757
1209409N/AN/A38363851GTGTAGCACCTTTCAC584758
1209422N/AN/A38983913CTGGTGATACCAGGAG174759
1209435N/AN/A39753990AACTCTCCCTCTGGAC414760
1209448N/AN/A40264041AGTTTCCAAGCTTGGT264761
1209461N/AN/A40634078TTCTTGAACCTACTTG964762
1209474N/AN/A42434258TCACCTTTCTGGCAGT334763
1209487N/AN/A43194334AGTATCCAGCAACCTA424764
1209500N/AN/A43524367CTCAGGAGAGTCTAGG794765
1209513N/AN/A46054620CCCCCCAGAGAGCTCT404766
1209526N/AN/A46604675TTGGTGCGGCAGGCTT264767
1209539N/AN/A50795094GCCCCACGCGGCGCAC464768
1209552N/AN/A54055420CGCCCTCTCGGCTCCT524769